Description :
From Genome Similarity Track
Location :
Scaffold_129:35618- 37117
Sequence
1499 bases(100 bases per row)
TCGACTTCATACTGGTTTGTACTTGTGTCTGGTTCCCAGCTGTCTTCAGGCAGTAATTCTTCATCAAAGTCAAATCGCTGAGTCTCTTCGAGTCGGCGAT
TAGCCTCGTCTTTGGTCTTCCGCCGAGTTCGGTGACTGCCTTCAGACGTGATACATGGACCACTGGGTAGAACCTATATCCACTCTTGTCGGGTAACTCC
AATTCATAGGCAAATTCTTCTACCTTCTTCTTCACCCTGAATGGTCCATGCCATCGGTGGGCTAACTTCTTGGTCAGGCCCGACTTGACTCGCTCCATAA
ACAACCAGACTTGATCTCCTTCTTTGAACAAGGATTTGGTGGATTTATCGCCTGGTTCTGCAACTTCATCTTCGTCATCTGCTGTGTTGGGAATGGATCT
TTTCTCCTTCTTGCTCAACGCTTCGTTGTGCTCTCGAGCTCGTCGTGCTTTCTCTCGCACTTGGAACTCAGCTGCTAATCGAAGTGCCACTTCTCGTTGT
CTGTTCGCTTCTCGGCGCCACTCGACTGCGTCCGCCGAGTTGACTGGGCGTCCTGTCCACGTCGTATTGAACTCGTCATAGCCTTGAGTGTAGACTTGGC
GTCCCAACCATGCACCAGATAGAAAGGGGTTTCTCGCCGAGTCGAATCTCTTGAGTTGTTGATAGCGTGTACCATCTTCTCGGCGATGTCATCCCAGTCG
GCTTGAAGTGGGTCTTCTACATAGACCCGTATAGTCTGAACCGTTGTCTTGACTGACCTCTCTTGTTGACCGTTAGCTTGTGGTCGGTAACTCAGCGTAG
CTCTTGATCTCGACTGCATCATCTCGGAGAACTTTTGGAACACTTCACTCATAAACCTTGGATCTCGGTCGTGCCGTATCAGAGACGGAGCCCCGAACTG
CCTGAAGACGCATTCCTCAAATACCTTGGCCACTTCGAGTGCTCCGGTGTCATTCATAGCCTTAGCGATAACGAACCCCGTGAAGTGGTCCTGGAACAGC
AGCAGTGCAGTATTGCCCCGCTGAGTTCGAGGAAGGGGAATCACGAAATCCATTGACACGACTTGGAATGGATGGTCTGACACCACATTTCCCGGCGAAT
AACCTCTCAACTGTGGCTTGCTCTTACTAGTATTGCAGTCCTCACAGGCCCTAACATGTTTCACCACGTCGGCGTAAATACTAATCCAGTAGTAGTCGGC
TTTGACTCGGTGATACGTTCTGACGATGCCTTGATGCCCTCCTTCGATCGAGTTGTGGCAGTTATGAAGTATTTCGTCGACCATGGTTGACGGAATCACC
AATCTCAATGAGAGGTTCGGTTCGCCGAGTTCGCCTAGTCGGCGGGCTTCATCTCGGCGGTATAACAGGCCGTCTTCGCTGAGTACAAAGACTTCTGCGA
CTTTGCCGGCATTCTGAGCTCGACGGTGTGTAAGGTCCTCCAATTCACCTCTCAGGTACGCCTTCAGATCGGCCCACTTGAGTTCTTCATCTTGTGCCT