Description :
From Genome Similarity Track
Location :
contig_7:35617- 37880
Transcript NameFunction/comments
g1990.t1hypothetical protein

Sequence
2263 bases(100 bases per row)
CCACACGAGGTACTCTTCCAGTAGTCCAAGCAGGTCGTCCAGCGTAGCCATGTAATTGGTTAAGGCAGATGCGTACTCGTGAGGCAGCACGTCAGAATCG
TACGATAGACAACAGAAGAGGGTGCTTCTCTCCTTTTCTGGGATGTACCAGTCTGGAGCAGAGACTCGCACCAGCTCTCGCTCGGCTTCTTCCGTGACAA
GGTGCTTATACGAAGCATGCCACTTCCTCACGTCGAAGTCGGTGCTCAGGATATCTTTTAGCGGAGCGTGTAGTTGATCCACCTGAAAGTTTTCTTTGGC
TACCAAGCCACAAAGAGAGAAACCTTCTTGACGTCGGCTGCCGATTTGGAGCTCCCAATCAAGGGTCCACTGGGCCACAGTGTCGGAACGGAGAACCTTG
GGTTGCCGGCTTTGGTCTGGAGGCTCTTGTCTTGGAGGGCCAAGCTGATGTACTCATCGAACTTTGACCGATAGAATTCCTGGTAGCTCCTGTTGACAGC
GACGTCCAGTGGCTGGAGCAGGTTGGTGAGATTGGGTGGGCCAAGAGAACGAAGACGTTATAGCGTTCCAGTCGCTTTGAGTCCGCCAGTTTCACGTGGC
ATCCATAGGAATCAATCAGATAGAGGACGGGCTCTCGGTAGAGCTGCGTCTCCTTCCTTCCGCAAACCACTGTCTGTGCATGAGCCAGGAGGAGGTCTTC
ATTCCACATGCCGGTCTTGTTGACATCCACAAGAAACACCAGCAGGACACTTGGGCTTGTTTTTCAGCTTGGAGAAGAGCAGGTGTGGCGTCAGAAACTC
GCCCTCCACTGTGGTAGTAAACGTCGCTGTGAAACACTTGTGGCTTGAGCCGCCCTTTCGCAGCAGAACCTCACGAACGCCGCGGGTAGTTATCGTTGAT
TTGGGCTCAGTCTCGAAGTAGCGAGGGACCTGGTTCATATGATGATGTTTTTGGGCTTGATTCCATGCTTGGCGATGAGGTGTTGGGCTTGCTGGATGAA
ACGCTGACAAACGTCAGGTGCATCAGCTGGTAGAGTCCGGGTTGTTGTCTGTCTGCGTGACACCAAGTTCCGACGTCTCTTGAATCTCGCTAACCAATCC
GACGAGGCCTCGAAGCCAGCTGCATTGCCGCCGTGGAGTTCGCGATAGATGTTGACCGCATGCAGCCGAATGTACGAGTCTTTCACACGCAGGCCTTTGC
TGTTCCGGTGGGTGACCCGCTCGTAAAGCAACTCCTCCATGTCACTGTGAGCTGGTCGTCGCCCACCACCGTTGAGGCGTCGGGCCGTTCGTGTGGTAAT
TCGTCGATCGCGCGAAGCCTTCTCCAGCTCAATTCGTTTCGCCTACCAGCCTCGAATGGTGCTAGACAAAACACCGTGTTGACGATCAAGAGCATGAAAA
CCCTTCCCTTGAACACCGGGCTCATATTCATCAAGAATTGAGAGCTTCTCTGTTATTGTGAAGCTGCGTCGTGAGCTGGGCATCGTGCACTGGAAAGCTT
CTGGTGAAGGTGTTGCTGGTAACGAGTGTTTTGTTAATGAGCTTATGAGTACATGCAACGTCGATGGCCACCGTAGAGAAGAATGGTTGGAGAGTAGGTG
GTCTAGCCATTTGTTAGAGTCAACCTAGAAGCCTTGGTTCAGACCTCGTTTAAAAGACCCTTTCCTCTGTGGGCGTCCTTCTATTCCGATACGTGTTGTG
ATCGGGGCTTTATATTGATTTTGAGCACATCGATTTTTTTTATTACGCCTAGACACTCTATGCGGGGTAAGACGGTAGGTTAGGTTAAAACCCTAAGGAA
CAGTGGACCACACTTCGACTGAGATGCCAATTTTGATCCTGCCCGATTATTGTTTCAGGACCAACTCGTTCTCAGCGTTTTTTTTTTTGCTTGAGACTCT
GTGTGTTTGGTAGTGGTCAAAACGTGTTTGATTTTACCCAGAAACTATTTGGTTTTAACCCGCAAACCAATAAAACGATATTTCGGTGGCGAATTGTCAT
CAAACAACATTCACGAAACATTCAATTCAGTCGACTTTCCAGCAACATTCTTTCTGAGCATTAAACCGGAAAACAAAAAATACAAAACTCCGAACTGCGA
TCAAGTGTGCCCGCGAACCAATAAATTGATGACATGCAACGAAAGCTTGTCAGAGCGAGAAATAGATGTGTGAGATGACTTTGGCAGTTCAATATACCCT
TCGCGCTACTTAGTCGTGCCCAAATATTGAGGTCACAACAGCTAACCAAAAGCTCAGATTTCT