Description :
From Genome Similarity Track
Location :
Scaffold_33:356137- 358323
Transcript NameFunction/comments
Phyci_221931tubulin polyglutamylase putative
Phyci_92443predicted protein

Sequence
2186 bases(100 bases per row)
AGAAGAGCTTGTTAATGCGCTCAGGGCCGTGCTTCGACATCATGTACAGCTTCAAGTTTCGCAGATCCCATTTTCCACCGTGCTACCGAATAAATACAGA
GCGACCCAACGTAAAGCAAGTAAACCAATCTGTAGTTAACTATAAATCATCGTACCTTCTTGTTGTAATTCTCCGAGGTTTTCTGAACAGCAACGTTCGT
GAGGTGGATGAAAGAGTTGGCAATGTCACTGTGATTGTTCGAGTAGCGCGAATTGGTGAAGCGCGCGAAGCCACCACGGAAGAGGTAAATCTCGAGCGGG
TAGAAGGACGGCACAAGCGCGTAGAGACGCAAGTCAAACTTCTTGCCGCCTACCAGGTAAGGGTTGGATATGTAGCGTTGCACCACGTAGGTCTCAACCT
GTTGGTTTTCAGGTCGCCAGCGGAAGTCTGTTCGCCAGTCGCTAATCTGGCTCAGCTTCGTAAACAGAAAGATACCTTTGCCCTGCGCTCTAGGTTACCA
CAAGCGAACAATGCAATCTCAGTTATGAACACCATAGTGACGTGAATCTATCTCCCGTGACGTTACGTACTTGCCAATGGGTTTCATAATCCAGACTCCC
TGGTTGCGCTTGAACTCCTCCACAAAGATAGCGTACTCGCCCGGGAGAATGTACGTAACAGGAAAGAAGTCGTACGATCCTAGAACTGTGTCAAGTTCAC
TCAGCGCTGCATCTTCTGACCTAAGGTACGTATATCGTTCGTGTCAGGTTGTCACCAGTGTTTTTTTTTTTTTGCCGAGATGAGAAACACCAATACCTCG
CTTTCTTGTCCATTTGTCTCTTAGCACGCTTGAGGTTCTTGATGAGGAGGTCCTTACGGCATAACTGTAGACACACCACTCAAGTAAGCCTACCTGATCG
CGAATAGCATCAGATTTGTTCCTGGGCATGATTACCTCTCGTCCGTTACGGTAGTGGTTCACTCGTTGCGTGTTTTCCAGGTGTACGGTGTCCAGTAAAT
CATAAATGTACTCGCGATCAGCCCAATAAAAATCCCAGTCGTTCTCAGTTGTCTCTTTCCATCCTCGACGCAGCAACGTGTCGTAGATGGTATTGCGAAA
CGTAGTCTTGAAGCGCATCACACTATTGCTGCTGCTCGTTGTGCCGCCACTACTGTTGGATGTACCACCTTTTCCCTTCGACCCACTGGCTGCGCTACCC
GAAGCGGTACTCGATCCGAAAACCAAGCTAGAATTTTGGCGAGATTGGCTCGAGCTGCTGGGCTCGCTACCGCTGCGGATCGGTCGACCCACTCTCGAAG
CACCACTGCCATTCCCGCCAGCACTGGACGGATTTCCATCAGCCTTCTTGTCGCCTACTGGCATCGCCACAGTCAATGACGGATTTTAGTTGTTCTCAAA
CCAAGCTTTATGATTCTGCAGGTCGAAGCGCCGCCCGAAGGCGGTTTCTACCTCGACTGTTGAAAAACTATGATAACTATGTATTGAACGTCTCAATCGT
GCATTGCCTTGCTCATGCAAAAAGCACGAGTGGTTCTACTGTAGCGATGAAGTAAAACTCACGCATACTTCACGCCACCCATGAAAGTGCGCGGATCGGG
TGCAGCGCCATTAAACTCGGCGTTGGAGAAGTCAAACCCAGGATTTTCCTCTTGGAACCGCTCCAGCATCATCTGCTGCTTGGTAGCTTCTTGCTGCATC
GGATCCATCTGTAGCAGAGCACTGACTGCGTCAGCACAGCTCTAATAGCAACAAATCAAATGCAGACCAGTACGCCACGAACCTCTCCGTGACCGATGAA
GACACTAGGCCAGATAAACCCCTTCTTCATTTTCTGCAAATTGATGTTCAGCTCTCCAGAGTCTGGATGCATGCATGAACCATATCAGCACAATAGCCAA
TACTTCCAATTCTCTCTCCCTAGTCAGCAGAAATGTAAAAGGTAAACTCACCGAGCATCCAGTAGCTCTCCGCGACCACGACGGGGCTAGCGAGGTCGTG
CTGGGAAGCGTCACACAGCGTTGCAAGTCAGATTACGACAGTAGGGGAAATTAGCAGTATACAGTAAGGCAGCTGTACATTGAGGAACTTGTCCGTGACG
CCACGCAACCCAAGCGTGACGTGGTTGATGGCGATGTCGCACTGAATTTGTTGCGCCGTGACGCCTGGCGGGGGCTTGATGAAGAC