Description :
From Genome Similarity Track
Location :
Scaffold_183:35607- 38896
Transcript NameFunction/comments
Physo_144377pectin methyl esterase
Physo_144378hypothetical protein

Sequence
3289 bases(100 bases per row)
TCAGTGGTTTGTCGACTCCAAATTCCTGTAGGGTTGTCGTAGTACAACCTGCTAAAACATACAATATGTTTTCTTCGGCATTTTTTTTAGAATATTTGTG
ATACTATAATAAAAAATGTCAAGTAACTTAAGACCTTTGGGCTAGACTTCAACCGAACAACGTCCGCGAGTTCTCCCAATTCAACGAGTCGGCCGCCAGT
AGTTCGATGGCATTCTTCAAGATAACGAGTTCAGTCCCGTCATTAACCGAAAGGGGGTGAATTCTAAACAAGGAGCACCCCTATATAAAAGATAAAGTAT
GCAAAAACCCCGGGTAGTGCGCCGTGTAGCGGGACACCGCCTGGTTACCGGAACATCCATTCGATGTTGTGCGAAGTGGACACATGTATAATAAATAATG
TTTATGTAATAAATGGGAAGGTTTGATACTGGCGCTTGAATGATTGCAATATTATATTGCGTTTTTAACGCTTTTAAAAAAGCGTTTTTTTTTACAATTA
TCAAGACCACAAACTAGCTACTCCCATTATTTTGTCTTTAATATTCAAAATTGTTATTGGAAATAGCTATAATGGTTTTTGCGAATGTTTCGGATCGACG
CAAAAGAAACGCGGTGTTGGGCGCTCCAGACAATTTCTTTGCATTGAGGTCCACCGAATGGGAAACCCGGCCGCTGTACGTCGGTGCGATCGGTTTTGGC
GGCAGTCCGTTTGTCGCTGCTCGATCGACAGCAGCCAGACACACGTAGCAGCCTAGCGAACAGCATTACCGTTTTCGGGTTGAGTCTCGAAAGTGTGTAC
AAGTTGCCGCTAATATCTTTCGACTGGCAAGTTCCAGGATCACCACTGTAGGTACCCTTACTTCCGACACCTAATACTCCTTATTACTTCTGAGTTTTAC
TGTGTTTATATTTATAAGGTTGCAGAAGACCTAGCTAATATATATTGATCGTTACGAGGTTTTCGCGCCAAAACCATTCATCACATTTTGGCAGGCAGCA
GTGAGGAGCATCGGGGGCAAGTGTGAAGAAGCATGATGAAGACACGGCGATGACGCAAGAAGAATTCTGCGCTGCTGCTGCTGCTGCTACTACTGCTGGG
TGTGGCACCCCGCCAGCTCCTGGTAGACCTCTCGCGGGACGAAGGCGAAGAGCAGCGCCGCCGCGGATAGGAAAAAGCTGCTCGACGCCACCCAGGAAAC
GTACGTCCCTGTGGACGCGTCCAGCACGTGCGCCGACAGTGCCTCGTACAGCGAAACGGAGAGCTCAAGCGCGAAGTGCCTGCGCTATATCTTAGCCCAT
GCTACTGGGGCTGGAGCTGAGTCGTGTTCGGCGCGCTGAGCCTGCAGCCGCCCACGGACGGAGCTTTTGGAGAAGGCCTACAAAGACCAGCTAACGCCAA
TGCAATGGAGCGAGGTAATCTGCGGTACGATGTGCGCTAAACTCGTCTCGCACTGCTGGTGCTATCCATACATGTAGTCTTGCCTCTCAATGGATCTGCG
ACCATGATGAGCTTGACCTCCATGAGCCAAAATACAGCTTAAACCCAAGCAAATACAATCCCCCTTTAAATCCGATAGAAAAAACCGATGTCGGAAGTGA
GGGTACATACAGCATTACCGGCGATCCCTCCAATACGAAAAACAAAGATCGGGTATCACCGGCGACGGTGCTGTCGTCACGAAGGATCCTTTCAACCGTC
ATTTGCAGTTTAACATATCGACCGCCAAGACCAGCGCCCCCATGATAGCGGTGGCTGCGTCTTGCAGACAAGCCCTCTCCTTTGCCCAGGACATGTAGCA
GTGTTGTTTAAGCGTTACTACATGTGGCGAGGCAGAAGCGATTGGTCTTGGAGCTCCGTTGCCGTCCTCCCTTGACCAGGGCCAGGAGCGACTTCAAGTA
GGCCGGCCCAAAAATCGCCAGAAAAAAGCACTTTTTAGCTCGGCAGAAAAAACACGTCAAACGGCCGCCATACAAAACGCCAGTCAATCGCCATTGCGTC
CGGCCTGCAGCAAAGACGACGCTTCGGCCCGCGCGTTTATTGTAGCCGCAGCCCGCAAGCAGGATGATCGGAACGCCCGCCGCCGCCTCTCGACCGCACA
GGCATCAGCCAGCACCACTTCCGCTTTTGACTCGAAGACAGAGCGCGCGCGCTGCCTCCTGATCCGTTTGGGGTTCCTGGACGCTGATCGTCTGCCCTCC
GTCCGTCTCGCTACAGTACTTTATTCCTCCTCCCACCCCCATCGCCACAAATGTCCACCGCCGCCATCGCGTGGATGTCGCCCATGGCGCCGCTGCCGCA
GCTCTCGGTCTCGGACGACCCGGCGGAGAACTCCAAGCAGGTGCTCAAGGCGCTCAAGTGCGTGGCCTTCTCCAGCAAACAGGTGGGCGACATGCTGCGC
CGCCGCCGCGAGCGCCTGGCGCGCCGCCTGCAGGCCGTGGCGGACGAGACGGAGCTGCTGCGCGCGCACATCGTGGAGAACGTGCTGAGCCAGCGCCAGC
GCGCCGAGCAGCTGGCCGAGCTGCGCGACGACCTGGAGCAGGCGCAGACGCTGGGCCACGCCGAGCTGCTCAAGGACCTGGCGGACGAGCTCAAGCTGCT
GCGCCGTGAGGACCAGCGCGAGCGCGTGCTGCTGAGCAACCTCAAGCGCACGCTGCGCTCCCGCGTGCGCCTGCACAAAGCGCTGCAGCAGCAGAAGGGT
GCGGCCGACGGGGCCACCGTGGTCTTCAACTGCAAGCACAACCTCATCCAGTCCATGGTGGCCACGTGCGCCAAGACCACGTTCCTGTCGGCCTCCGAGC
TCGGCTACTGTAGTGGGTTTCGAATGAACACAGTCACGAGGAAAGCTGGCGCTTCCTTTGAACTCCTTGCTTGTTTGGTTGTTCTCAAGTTCTAGAGTGA
GGAGGTTAGATAGACCTCAGATAGGCCTACAAGCTCTAGTAGGATACCTGCTCTAATCTAACCACCTCGTGGTCTTATCCTACGCCAGCTTGGCTCTGAT
CATCCTCGATCGACAGCCCAGTGCGTGGTCAGGTCGTGAAGACCATCGCCCCACTTCACCGCCCCACCCAGACTTGACCACGCCGTTGAGAGTGGTGATC
AAATGTTGGCCTTACAGGAATGTTGCTTGAATGTACCCATGTACCCGAATTGCGGTACACCTTACCAGTGGTAACTTTAGCACTTCAACTTGAAGTTTTA
AAGTTGCTCGACTGCTGAAACAAACTCCAAGTCGCTCTTACCAGACGCATACTGCTTCACCATCACGGGAATGTCCTTGTACAAAGAAC