Description :
From Genome Similarity Track
Location :
Scaffold_48:355874- 357449
Transcript NameFunction/comments
Physo_136823hypothetical protein

Sequence
1575 bases(100 bases per row)
GCGGAGCTCGCGCACGTTCCTCCGGCTTCTTGCGAAGCGTGGTGAACTCCTTCAGTGTGAGCTTGTGTGGTGCTAGTAGCACACACCGAGCGACTTCAAC
GTCGCCAAGAAAGAGTGGCTCTTTCTCAACAAGAGCACGCTCATAGGAACCCCTCGAGGTGTACCAGCCGATAAGGCCACGAGGAGCCGAGAGCTTCGCC
AACAGCGCTGGCGCACCAGTGCCAGGCTCGGGCGGGAAGTAGCCCTGCGGGTACGTGGCATCCCCGCCTGAAGAAGACTCGATGGCAGTCGTGGCAGTCG
GCTGCCTGGTATACGCACCCGAGCTAGCAGCGTGGTATTGCTGCTGCTGCTCGTCGAGGTTGTTGGAGAGCTCCTTGGGCTCGTGGACGGCACCCTCCTC
GTCCTCAGACTCCGAGTCGATGAACAGCTTGGAGCTGGAGCCGCGAGGCGACCTGGAAGCTGAACGCTTCTTCGCCTTGGCCTCGGCGGCCTTCGCAGCG
GCAGCCGCTTTCGACGCTTGGGCACGCTCACGACCTTGTGCCAGCGTCAGATGCTTGGATGCCAGCACCTCCTTGGGCTTGGAGCCCGCGTCGCTCGGCG
ACTTCTCGGCCACGACCCCAGCGTCGGCCATGGCGACTTCGTCGTGCGACTGCTTGCTGTCGCCTGAGCCGGACTCGGCGTCCTCCGCCTCCTTCTCTGA
CGAGGCCTTTGCGTCGGCCGAGGCGTTGGTCATGTCGCCTGCCGCCAGCTCCGTGCCTTCGGCAGCGTGCGTGCTGCCCTCCGAGACGTTCTCGTCGTCG
GGTGAACTCTCACCGGAGTACTGGACCATCGTGCAGTCAAAGACGGCGGCTTCGCAGTCGCGAGCCGGGCTTTTATGGCCCCGAGGACTCTCCTCCTTGC
CTTGCGCGGCGTCAGGAGACTTGCTTCGAGCCCCGGCCTGACGGCCACTCTCCGGCGTGCTGCTACGAGAGCGCACCACCTCCTCGGCCGCCTTCGTGGC
CTCCATCAGCGCGGACGACTCGTCCTTGGCCTTGGCCGCCCTGGTCTTCGGCCCTACGGCCCGCGGTTTCGGAGGTGCTTTTGCACTGCGCGCACTGCGC
TTTGGAGGCATGCTTCCGGTCGACGTGGAGACCCTGTGGCTTGCTCGGCGATGCGCCAGTTGCTCTGTGTGGCCCGGGAGCCGAGGCGCCAGAGCTCGTG
CCGTTTTCGATGGATTTCGACTTTGCGAGTGAAATGTGAGTCGCCGGCGTAACCTCGCTCTGATTGGTCGATAAGATCGAATCTAAGTGGGGGAGGATGT
AACGGGGTTACATGGAATAGTGACCCTGTCACTATTCTGGGATGGCTACATCGGTCACTCCCCTGGATAGTGACCCAAGTGGCCTCAGAGCCAACAGATA
CATTTTGTATGACACAAACTATAGGGAACTTAGGATCTGTATGCAGGCCAAATCTGTACCAACCTATAAATACATTCAGTCTTAGATCTACCGCTTTTCA
AGTCAAGTCGGCTGTTCACTTGGAGTTTGTATACTCCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCCGTCACA