Description :
From Genome Similarity Track
Location :
contig_37:355750- 364081
Transcript NameFunction/comments
g9382.t1RAW25774.1 Transketolase 1 [Phytophthora cactorum
g9383.t1hypothetical protein
g9384.t1hypothetical protein
g9385.t1KUF79835.1 Negative elongation factor D [Phytophthora nicotianae

Sequence
8331 bases(100 bases per row)
GCCGCCGTGGAGAACCAGCACAAGACGTCGGTGCTCGCTCTGACCCGTCAGGGCCTGCCCAACCTGGCCAACTCGACCGCCGAGGTTGTGGCCAAGGGCG
CCTACATCGTCGCCAACGTTGCCAACGGCGCCGAGGTGGAGTCGCTGGAGGGTGAGCCGGATCTCGTCCTGGTTGCTTCCGGCTCGGAGGTGTCGCTCTC
GATCGACGCCGCCAAGCTGCTGACCAACTACAAGGTGCGCATCGTGTCGGTGCCGTGCCGCGACCTGTTCGACGAGCAGTCGATTGAGTACAAGAAGGAA
GTTCTGGGTGAGGGCATCCCCGCCATGAGCGTGGAGGCCGCTGCCACCTTCGGCTGGGGTACCTACTCGCACACGCAGTTTGGCCTGGACCGCTTCGGCG
CTTCGGCCACCATTGCCCAGCTGAAGGAGCACTTCGGCTTCAACCCGAACACCGTCGCTGACGAGGCCCGCAAGCTGGTCAAGTTCTACGACGGTCGCTC
GGCTCCGAGCCTTTTCGACCGCCCGGCTCTTCGTGTGCTCAAGGCCACGGACCACTAAGCACCCTTAGCGTGCTGTTGGCAGTGTGAGGAAGTGGACGAA
GTGAAGCAACCCGTATTGACATGTGAATCCTAGCTTGTCATCGTCTTCAACATCTGCCTCGTCTCCGTGCCCTTTTTAATCCAATCATATTACACTTCCA
TCTTATTGGCCTAAACGCAGCCAGCATTTCAACCTATCAAAATCAAGGGAAATATCCATTAGAATTCAAATTTGAACGTCGACGAGAGCAACTTGTAGCT
GCTCCGCTGCATGGGCCTTCCTCGGCTCTAGAAACGAATCCAGCGGCATGGCGACACTACAGACAAAGAACATGGACCCGCAGCTCGCCTCCAGCTCCTC
GTCTGATGTTTCGAGCTCTCTGACGTCCTCCAGGGGACACAAGATCCGTCCAAAATCGAGTAAAATTCTCAAAAAAACTTCGGCACGCAGGGAACTCAAG
CGCTCCATCGAGAAGAAGTTCCGGCTGCGCTACGCGTCGCTGCAACTGGCCTACGAGCAGCGCCTGGAAGTTCTGGCCAATCGCGTGCAGGAGGCCGTGA
GCCAGGTGCACGGAGACGCCACCATCCACTGCCTGCAGGAGAACGCGCTGACCAATGAGTACGCGAGCGCACGGCTGGGCGAGATCGTCCACGAGTGCTT
CTACGGGGAGAGAGAGCGGTACGTCAAGGCCATGAGCGACCAGATCGCGTGGCAGGCTAGCGATCTTCGGGAGGCGCAGCAGAAGCTAAGAGTCGTGCAG
AAGCGAGAGAGCGACGCGCAGCGGCATTGGAAACTGGCGCAACAGGATATCCAGGCGCTGCACCATCAGCTGGATGTGAGGGTGAAGGAATTACAGGAAC
AGAAGAGGAAGGAAGGGGATTTCAAGATGCGCGGCCGTGCGGTGATTGAAGAACGAGATGCGGCGAGGAGGGAGGTGGACGTGCTGAAGCAGAGTGTCCA
GACACTGGAGACGCTGCAACAGGAGCATGAAATGTTGAAGAATAGGATGCAACGTGAAGGTGAAGAGACACGAGAGGCTCGTGGCGAGCTGGAACGGAGT
GTCAAGAGCTTGCAAGAGGCCAAAAATGTACGTGCTCGTTGGGAGGCTCATGAAGCGGTGGGGCTCGTGTTGATTGTTGATTTGTGTTGATTGCAGAAAT
TGGAGCTAGAGAAGCAGGCGAGTGAACAGGAGGTGCTCCATTTGAAGCACTTGCTGACAATCTCGGAGAGTAATACCCGGGAAGTAGGGCAGACGCTACA
GCTACTGCAGAGTGAAGATTACCCAAGTAAATTGGCGCGCTTCGAGTCCGAGCTGACTCATCAACAACAAATGGCTGTGCTCGCCGAAAAAGACCATGAG
GATCTTAAAAAGAGATATGAAGAGTTCGGCGAGCAGGTGGATCAGTACATGAATGAACAGGCACAAGAGAAAGCGGCGCTAGTGTTGAAGGGCGACGAGC
AGGTAAAACAACTCCAGGTCCAGCTGGATACCGTTGGCCGACAAGCTCAAGATGCACTCAAAACCAAGCAAAGTGAGATTGCACGGCAATGGATCAAGTT
AAATTTCGACAAGAGGCACTGATCAAGGCGGATAAAAAGATTGCATCCCTTGAAGAGCGTGCGACTGCGGTGGAGGCCCAGCAAGTAGATATCAAGTTAC
AGCACGAGAAGAAAGTTGGAGGCTTGGAGAAGGAAGTTGTCCAGTGGCGGCACGCACTGGAAAAAGAACAGGAAAAAGTTATGACTCTCCAAAATGTGCT
GGCAGAAGCGAGAGATAAATACGAACGGAAGATCTCTTCGCTTCAAGACGCAATGAACCGGCAAAACCGACAAGGGGCCCAAGAAAAGGAGTTAGAGGCT
CGTACACGTTGGCAGAATGAGTTCGTTGCTAAACAGGATTCAAGGATCGAGGAGCTGAAGGAGAAGTACGATACTGCATTGCAGAACCAGCAGACAGAAC
TGCTTCAGGCTCGGCAAATGGCATTGGAAACCGCTAATACCGCAGCAGTGAAGTGGGAAAAGGCGAAGCTTGCTCAAAAGGAGGACGAGGAGCTTGAAAG
ACGACGCCGATCCGAAGATGCGGCTCGAGAAAAAGAACGGAAAGAAGAGCAACGAGTGCTACAACTCTCCCAAAGGCGCATGCAGCACGAATTTGACGAG
CGAGAGAGACGTCTTCTGGAACGAGAAAAAGCGCTGGCAGAAAAAGAAAAACGGGATGATCGCCGGAGGCAAGAAGAGGCGAAGAAGGCGGCAATCCCAC
CTCCGGCACCTACTACGCCAAGTGTTGTCGTTTTGAATATGGGCTCTGTCGAGGATGGCGAGGTTGGAGATCAACGAGCGACGAGTAATGCGGTGGTTAG
AGTAGCTCCTACAACCCGTCGCCACAGTAGAAAATTTTCGGAAAGGGAACGCCATGAGCAGGGGGAAACCAACGACAGTATTCCCCTTGCGCAGCATACG
GCTGAGATACAAGCAAAAGAAGCTCAAGCTGCCTTGCGTGCAGAAGAAAGAGTGCAAAAGCTTATGCAAGAGTTTCAGGAGCGAAAAGAATCCGAGTTTC
GGGCTGCAATGGTGAATGTGAGGAAGGGCATTCAAAAACTGGAGGTATCACTGGAGGAGGCGAGAGCGGAAAAGAAGCGGATTGAGGAGCAGCTATTGAG
TGAGCGTCAGGCATTTGTCACTCTGAAGAATGAGCACGATGAATCCAAGGATACAAAGCGTACGCTTGTGCAGAGGCTGGAGGAGGCGAACGAAAATCTC
GGCAGACTTCGGAATGTTGTGGGCGATTTGCAATCTAAGTGTCAATCACTGGGGGAGCAGTGCAAAACCGCCGTTGCGCAGAAAGAGGAAAGTGAAGCTG
CAGCTGATAATGCTCACAAGGTTAGCGAAAATCTTCGCGAACAGCTTGCACGCCTAACTGAGGCAGCCGCTCGTCTTGAAAACTCTCTTGACACATCCGT
GGAATCAAGTGAGCAATCGAAAAAGGAGCTGCTCGACCGAATTGCAGTGCTGGAACACCACATTCAAGTTCGAGAAGAAAACTTTGAGGCGGAAATGTCT
GCCGTAGAGGAGGCAAATACACGCGAGCTGCGTAACGTGTCCTCACAGTATGACACGCATTTGCGCAAACTCCAACAAACAATCGACGAGTCACAGCAGG
GGCGCTTGGAACAGGAAACGAATGCCAGTCAGTTAGAGTTGTCTGTGCACGAATTGACCGCTGCGAAGAATTCCTTGCAAGCTATGGTGGACCAGCAGAA
AGTTGAGATAACTCAGCACAGGAAAGAATTTGCCGACTTGTCACGTATGCACAAGAACCTCGCTGAATCCATGAATGGTCGAGTGAACGCTGCAAACGAA
GCTGTGGAAGAGGAACGAGGAAAACGCATCACGGCTGAAACGAGAGCGCTAAAGGCAGAAAAACTTGTTGAGCGAGTCAAAAATGAGCGTGAAAAATGCG
TGAGTGCTTATCGTCAGAGCCTGCAGCAACTGGTACACGACTGGAAAGAAGTGCGCAAGGGTGTTACGAGTGAAATGAATGTTGGCTGGGTACACTTGCA
AAAGGAACTCGCGTTGGCTGGTGTGGAGTGGAAGAAACGAACGGATGATCTCCTTCAGGGAGCCGACTCAGTGTGGAGACGGAAAGCCAAAGAAGATAAA
CAAGAGTGGAAGACGCGCATTGCTCAAAAAGACAAGGAAATGGATGGATTGTTGTCCAGCCAACGCGTGAATGATCAGTCCAAGTATGACCAGATTGTGG
AGCGTTTGGAAAAAAAAGCTCGTGAATTAGAAGAGCTAGAGACGCGGCTTACTGCCCAACTGGACCTAAACTCCGATTTACAGCAAACTATTCAGAAGCT
TGAAGAGGAGCAGATGCTTCGGCTGGTAGAGCAGTCGCACCTTGAGGAACGCTTATCCGCTGCTCAGGCTGGTATTCACAAAGAGACCCAGGAAAAGGAG
CGCGTGAGTGCCTTATTGAAGACACGGAAAGCAATGTGCGAAGAATACCGTGGATTCGTCGCATCGCTTGCTAAAATGAGTGGATCTGACTCTGCTATTA
CTGAAAAGAGTCATGAGAGGGCTGGGGACGAACAAGCGGCTTGGGAGCGTCGGCAGTTCTCTGATGAATTGGGTAAGCTAACAGCACGCCTCCAAGAATC
CCAAGCTCAAGCGATTCACAACGCTATTGCTGAAGCGACCGTCAGCACAAAGGAAGGCGTCAGTGCACCTTTGGTGTCCGAATTGGAGTCCGCAAAGAAG
GCGTTGAAGTTTTTGTGGAGTGAGCCAGTACTTAGTGATAGTGAGTACGACGGACATCTTCCATGGTATCTTCGTTCTGTCCGAACTATCAGGAGAGAGC
GGGAGGCGAACGAGGAAACGGTGTCAGCGCTTCGACAGGAGCTTGCATCAAAAGAAGTGCAGAAAAAAGAGGTGCTGGAGAAAAAGATGAAATGGCAAGA
GGCCAACAATTTGCTGCGTTTTGAGAAGGACACCTTACTGCGAGAGATGGATCTGCTCCGCCAAACGTTGCAAAAAAAGAAAGAGCAAGAGCTTCAAGAG
CTTCGTGCGGAGTATGATGCGCGCATCGAGCAGTTGAAGCAGCGACACGACCGATCAATTATGAAATCGGATCAGGATTATGAGGTACGGTCATTGTTAC
TATGAAGGCCTAACTTTTCTCCCCTCTCGCTAATCTCGCTAATCTCGGTGTATTGGGTTTTGGCAGACTGCGACGAATCAGTTGAGGGATGTACTCGAAG
CAGAGCGGCGAGCCACCAACCATGCCAAGAACGAGCTTGTTGAGCTGGTAAGATAGTGCGCACGATGTTTTATTCTGCATCATTGATGGATGACACCACG
TTCTTCCTACTTTTTGCAGAGAATGGCGTTAGAGCGAACAGAAGAAGAACTCAAGGAAGTACATCAAAAACTTGACAAGGAGACGGATGAACTTCGCGAA
GCGGTGAGAATTTGTACTTTTGCGCAGTTTTATTCAACGCCCTGCTGACTGCGAATTACCTCTTCAACATACAGGCAGGCAAGTGGAAGCGGAAAGCCAA
ACTGGCCATGAAGAACGCTGGCGGTGGGGGTTCGACGAAGGGAGCGCTGCGCATGTCGTCATCATCGCACGGAACGGAGGAGGACTCGGACGCGTCGTAC
CGCATGATGTATCCGCAATCCCGACGAGCGTCCAACGCCATGACAGACTTGTCGAATCTGATGGAGCAATCGCTTGTCAGCATCCGAAAAGAGGCTCTGG
TGCCGCTGTCTCCACATCTTCAAAGATAGACAACATTCTGTAGTAAAGGCTATTTAGTCATTGTAAACAGCGCACACGTGCGTGTTTGCACAAATGCATT
GATTTCATTTATTGCTGAAGCAGCTCCTGCTTCCACATAGCGAGCATCTTGCGCAGCTCCGGCTCCCAGGCACTCACCACCTTCTTTGCGGCGAGTTCGC
GCTGGCTGCTACCGTTGGTTGAGACGAGCACCTCATAGTCGTCGCCGCTCGTGTCGTCAAAGTCCTGCAGCTCCACATGGCCCGATACATCGTCACTGCC
CTCCCACGCGAACTTGACCGACAGTTCGTAGCCGCAGCGCTTTTTACCGCGACTAAAGACGATCTTCTCAAAGCACGAAATCTCAGCCACAAACCCCTCT
TCAAAACACTTTTACCCACTCACCTTCGCTTCACCGTCACAACGCACAATGGACGTGGCCTTGATGGACAGTCCCTGCGCCTCGTCTTCGAAGCTGAAGG
CCGTGAGGATGTGGTGTTTCAGTCGCTCACGAGCCCACTCGGACTTGTCGCGCTCCTCCCTGCAGACACCAGTTAGAAAAACTCCTTCCCCGCCGACACC
AACCAGTAACTCCGCAGCGCACCAAGTGCCTGCCGCATTCCACACGGAGCTGGAGTCGCTCCGATGCACGGGAGCCGTCACCGCCGCCGAATGGTCGATC
CGCACAGGGGTGAAGTCCTGAATCCGCGGAATTCCAGCACCAAAAACAGCATTTTAGTCCCCATTTCAGCAGTAAATTAATGCTACTACACCCGCACCTG
CGACGTCTTGGGGATCGTCTTCATCCAGCCGTGGTACCCGCTGTGCATCTTGGGGGCGTCTTCCTCACCGCTCGACATCGTATCTGCTGGAATATTCGAT
AATGACGCCGCATTCACGTCTTTTCATCCAATCACCTACCTCCACTCTCCTCATTCGTTAAAAATCAAATCATCATCTACCCATACATTAAAAAAGGTAG
AGCGCCCTACCATGCCGGGTGTCTGGAGCGCGCACGTGACCAAGGAGGGCCGCACATACTTCTACAACCGCACCACGAAGCAAAGCGCGTGGGAGAAGCC
CGAGGACTTTGACGGAGACGAACCCCCTGCCCCCTTTGGCGCCAAGAGGCTCGAGTGGGAGGAGCTCTGGGACCCCAAGAACGAACGCGCCTATTACTAC
AACCGGGCGACGCGCAAGACCCAATGGCAGAAACCCGAGGGCGTGGAGATCAAGCCCCGCGCGGGAGCGAGCGACAAGAAACACGACAAGCACCGAACCA
AGGCCAGGAAGGGCGACGAGAACGGTTCTACCCCGCGGGAGAACGAGCCTACCGAGGCTGAGGAGAGCAAGGCTAAAAGTAGTCGGGAGGAGAATCAGAC
GCAGAATCAGGCTGAAGATCCGAATCAGACTCGGAACGACGATGTTAATGCACAAGAAGCAGCGCCGACGTCGACGCATAGCAAGAAGAAGAAGAAAAAG
TCCAAGAGGGACAAGGCGGACACTGCGGTGGTGGACACTCAGAGGAAACGGCGTCGACAGGATGAAAAGCGACTCATTATTTGGGATGATGAGGAGCAGG
GAGTGGATGTTACTCGGGGCATTGAGGAGAAGGATACGGAGGACGGCAAGGAAGCCACTAGATTGCTACAGGAGCTGTCCACGACGGACGCTATTATGGA
AGCCAACGTGCTCTCGGTGATTAACGGGTTCTTGAGAGCTCATACCGAGTCCAATGGCCCGGAGATTCTCGTGGAAAAGCTGTCGTCCTCGTACCGTGGC
CATGCGCAGATGATCGGCCTCGTGGCGTCGTGGCTGGACACGCTGCCGGTTTCCACGACGGCGTTGGAGAACAAGATGACGTTTGATGTGAACGAGGGAG
CGGTGATCTCGAACAAGGGCGCGTCGTGGGACCCGGCCGAGGAGATTCTGTACAGTCATCTGAAGGACGTTATTAATGAGAACTACGACCCGAAACTCGT
GTCGAATGTGCTGAGCGGGTCGGCGGTGGAACCCGAGTGGCTGACACAGATGCTGAACGATCGCAAGTGGCGACTTATGCTGATTGAGTTGGCCGAAACA
CACAAGGTTTGTAGTGATCTTGTTGTGGAGTTGATGATGGCAGATGCTGACGGTGTCGCTTTCGTTTTTCAGACATGCACGTTGCTGCAGTACGCGATCC
GACGAATCTCAGAGGCTGGACACCACAAGGAAATTGCCTCTATCACGAGCGCGAATGCTTTCTTCCCTGTGTTCGGCGGTGTGTTGGTAGACGCCTTCAG
CCGAGTAAGTATGGTCTTGCTCCTACGGCTTTAACCTTACGTAATCTAACTGACAATTGTCTCCCACAGATTCCATTTGCCAACGAAGAAGAAGTGGTGG
AGGACATCACCGCACTCAACAAGATTTGCTGTCAGTCTTCGCACTCGTACGTCTATGCACAGGAGCTCCTTTGTTCAATGGACGACAAGCTGTATTTGAT
GCAGAAGGATGCTGGCGCTGAAAGCGCAAAG