Description :
From Genome Similarity Track
Location :
contig_37:355723- 364054
Transcript NameFunction/comments
g8953.t1RAW25774.1 Transketolase 1 [Phytophthora cactorum
g8954.t1RAW25773.1 hypothetical protein PC110_g17814 [Phytophthora cactorum
g8955.t1hypothetical protein
g8956.t1KUF79835.1 Negative elongation factor D [Phytophthora nicotianae

Sequence
8331 bases(100 bases per row)
GCTGACGGTAACGAGACGGTGGGTGCCTACATCGCCGCCGTGGAGAACCAGCACAAGACGTCGGTGCTCGCTCTGACCCGTCAGGGCCTGCCCAACCTGG
CCAACTCGACCGCCGAGGTTGTGGCCAAGGGCGCCTACATCGTCGCCAACGTTGCCAACGGCGCCGAGGTGGAGTCGCTGGAGGGTGAGCCGGATCTCGT
CCTGGTTGCTTCCGGCTCGGAGGTGTCGCTCTCGATCGACGCCGCCAAGCTGCTGACCAACTACAAGGTGCGCATCGTGTCGGTGCCGTGCCGCGACCTG
TTCGACGAGCAGTCGATTGAGTACAAGAAGGAAGTTCTGGGTGAGGGCATCCCCGCCATGAGCGTGGAGGCCGCTGCCACCTTCGGCTGGGGTACCTACT
CGCACACGCAGTTTGGCCTGGACCGCTTCGGCGCTTCGGCCACCATTGCCCAGCTGAAGGAGCACTTCGGCTTCAACCCGAACACCGTCGCTGACGAGGC
CCGCAAGCTGGTCAAGTTCTACGACGGTCGCTCGGCTCCGAGCCTTTTCGACCGCCCGGCTCTTCGTGTGCTCAAGGCCACGGACCACTAAGCACCCTTA
GCGTGCTGTTGGCAGTGTGAGGAAGTGGACGAAGTGAAGCAACCCGTATTGACATGTGAATCCTAGCTTGTCATCGTCTTCAACATCTGCCTCGTCTCCG
TGCCCTTTTTAATCCAATCATATTACATTTCCATCTTATTGGCCTAAACGCAGCCAGCATTTCAACCTATCAAAATCAAGGGAAATATCCATTAGAATTC
AAATTTGAACGTCGACGAGAGCAACTTGTAGCTGCTCCGCTGCATGGGCCTTCCTCGGCTCTAGAAACGAATCCAGCGGCATGGCGACACTACAGACAAA
GACCATGGACCCGCAGCTCGCCTCCAGCTCCTCGTCTGATGTTTCGAGCTCTCTGACGTCCTCCAGGGGACACAAGATCCGTCCAAAATCGAGGAAAATT
CTCAAAAAAACTTCGGCACGCAGGGAACTCAAGCGCTCCATCGAGAAGAAGTTCCGGCTGCGCTACGCGTCGCTGCAACTGGCCTACGAGCAGCGCCTGG
AAGTTCTGGCCAATCGCGTGCAGGAGGCCGTGAGCCAGGTGCACGGAGACGCCACCATCCACTGCCTGCAGGAGAACGCGCTGACCAATGAGTACGCGAG
CGCACGGCTGGGCGAGATCGTCCACGAGTGCTTCTACGGGGAGAGAGAGCGGTACGTCAAGGCCATGAGCGACCAGATCGCGTGGCAGGCTAGCGATCTT
CGGGAGGCGCAGCAGAAGCTAAGAGTCGTGCAGAAGCGAGAGAGCGACGCGCAGCGGCATTGGAAACTGGCGCAACAGGATGTCCAGGCGCTACACCATC
AGCTGGACGTGAGGGTGAAGGAATTACAGGAACAGAAGAGGAGGGAGGGGGATTTCAAGATGCGCGGCCGTGCAGTGATTGAAGAACGAGATGCGGCGAG
GAGGGAGGTGGACGTGCTGAAGCAGAGTGTCCAGACACTGGAGACGCTGCAACAGGAGCATGAAATGTTGAAGAACAGGATGCAACGTGAAGGTGAAGAG
ACACGAGAGGCTCGTGGCGAGCTGGAACGGAGTGTCAAGAGCTTGCAAGAGGCCAAAAATGTACGTGCTCGTTGGGAGGCTCATGAAGCGGTGGGGCTCG
TGTTGATTGTTGATTTGTGTTGATTGCAGAAATTGGAGCTAGAGAAGCAGGCGAGTGAACAGGAGGTGCTCCATTTGAAGCACTTGCTGACAATCTCGGA
GAGTAATACCCGGGAAGTAGGGCAGACGCTACAGCTACTGCAGAGTGAAGATTACCCAAGTAAATTGGCGCGCTTCGAGTCCGAGCTGACTCATCAACAA
CAAATGGCTGTGCTCGCCGAAAAAAACCATGAGGATCTTAAAAAGAGATATGAAGAGTTCGGCGAGCAGGTGGATCAGTACATGAATGAACAGGCACAAG
AGAAAGCGGCGCTAGTGTTGAAGGGCGACGAGCAGGTAAAACAACTCCAGGTCCAGCTGGATACCGTTGGCCGACAAGCTCAAGATGCACTCAAAACCAA
GCAAAGTGAGATTGCACGGCAATGGATCAAGTTAAATTTCGACAAGAGGCACTGATCAAGGCGGATAAAAAGATTGCATCCCTTGAAGAGCGTGCGACTG
CGGTGGAGGCCCAGCAAGTAGATATCAAGTTACAGCACGAGAAGAAAGTTGGAGGCTTGGAGAAGGAAGTTGTCCAGTGGCGGCACGCACTGGAAAAAGA
ACAGGAAAAAGTTATGACTCTCCAAAATGTGCTGGCAGAAGCGAGAGATAAATACGAACGGAAGATCTCTTCGCTTCAAGACGCAATGAACCGGCAAAAC
CGACAAGGGGCCCAAGAAAAGGAGTTAGAGGCTCGTACACGTTGGCAGAATGAGTTCGTTGCTAAACAGGATTCAAGGATCGAGGAGCTGAAGGAGAAGT
ACGATACTGCATTGCAGAACCAGCAGACAGAACTGCTTCAGGCTCGGCAAATGGCATTGGAAACCGCTAATACCGCAGCAGTGAAGTGGGAAAAGGCGAA
GCTTGCTCAAAAGGAGGACGAGGAGCTTGAAAGTCGACGCCGATCCGAAGATGCGGCTCGAGAAAAAGAACGGAAAGAAGAGCAACGAGTGCTACAACTC
TCCCAAAGGCGCATGCAGCACGAATTTGACGAGCGAGAGAGACGTCTTCTGGAACGAGAAAAAGCGCTGGCAGAAAAAGAAAAACGGGATGATCGCCGGA
GGCAAGAAGAGGCGAAGAAGGCGGCAATCCCACCTCCGGCACCTACTACGCCAAGTGTTGTCGTTTTGAATATGGGCTCTGTCGAGGATGGCGAGGTTGG
AGATCAACGAGCGACGAGTAATGCGGTGGTTAGAGTAGCTCCTACAACCCGTCGCCACAGTAGAAAATTTTCGGAAAGGGAACGCCATGAGCAGGAGGAA
ACCAACGACAGTATTCCCCTTGCGCAGCATACGGCTGAGATACAAGCAAAAGAAGCTCAAGCTGCCTTGCGTGCAGAAGAAAGAGTGCAAAAGCTTATGC
AAGAGTTTCAGGAGCGAAAAGAATCCGAGTTTCGGGCTGCAATGGTGAATGTGAGGAAGGGCATTCAAAAGCTGGAGGTATCACTGGAGGAGGCGAGAGC
GGAAAAGAAGCGGATTGAGGAGCAGCTATTGAGTGAGCGTCAGGCATTTGTCACTCTGAAGAATGAGCACGATGAATCCAAGGATACAAAGCGTACGCTT
GTGCAGAGGCTGGAGGAGGCGAACGAAAATCTCGGCAGACTTCGGAATGTTGTGGGCGATTTGCAATCTAAGTGTCAATCACTGGGGGAGCAGTGCAAAA
CCGCCGTTGCGCAGAAAGAGGAAAGTGAAGCTGCAGCTGATAATGCTCACAAGGTTAGCGAAAATCTTCGCGAACAGCTTGGACGCCTAACTGAGGCAGC
CGCTCGTCTTGAAAACTCTCTTGACACATCCGTGGAATCAAGTGAGCAATCGAAAAAGGAGCTGCTCGACCGAATTGCAGTGCTGGAACACCACATTCAA
GTTCGAGAAGAAAACTTTGAGGCGGAAATGTCTGCCGTAGAGGAGGCAAATACACGCGAGCTGCGTAACGTGTCCTCACAGTATGACACGCATTTGCGCA
AACTCCAACAAACAATCGACGAGTCACAGCAGGGGCGCTTGGAACAGGAAACGAATGCCAGTCAGTTAGAGTTGTCTGTGCACGAATTGACCGCTGCGAA
GAATTCCTTGCAAGCTATGGTGGACCAGCAGAAAGTTGAGATAACTCAGCACAGGAAACAATTTGCCGACTTGTCACGTATGCACAAGAACCTCGCTGAA
TCCATGAATGGTCGAGTGAACGCTGCAAACGAAGCTGTGGAAGAGGAACGAGGAAAACGCATCACGGCTGAAACGAGAGCGCTAAAGGCAGAAAAACTTG
TTGAGCGAGTCAAAAATGAGCGTGAAAAATGCGTGAGTGCTTATCGTCAGAGCCTGCAGCAACTGGTACACGACTGGAAAGAAGTACGCAAGGGTGTTAC
GAGTGAAATGAATGTTGGCTGGGTACACTTGCAAAAGGAACTCGCCTTGGCTGGTGTGGAGTGGAAGAAACGAACGGATGATCTCCTTCAGGGAGCCGAC
TCAGTGTGGAGACGGAAAGCCAAAGAAGATAAACAAGAGTGGAAGACGCGCATTGCTCAAAAAGACAAGAAAATGGATGGATTGTTGTCCAGCCAACGCG
TGAATGATCAGTCCAAGTATGACCAGATTGTGGAGCGTTTGGGAAAAAAAGTTCGTGAATTAGAAGAGCTAGAGACGCGGCTTACTGCCCAACTGGACCT
AAACTCCGATTTACAGCAAACTATTCAGAAGCTTGAAGAGGAGCAGATGCTTCGGCTGGTAGAGCAGTCGCACCTTGAGGAACGCTTATCCGCTGCTCAG
GCTGGTATTCACAAAGAGACCCAGGAAAAGGAGCGCGTGAGTGCCTTATTGAAGACACGGAAAGCAATGTGCGAAGAATACCGTGGATTCGTCGCATCGC
TTGCTAAAATGAGTGGATCTGACTCTGCTATTACTGAAAAGAGTCATGAGAGGGCTGGGGACGAACAAGCGGCTTGGGAGCGTCGGCAGTTCTCTGATGA
ATTGGGTAAGCTAACAGCACGCCTCCAAGAATCCCAAGCTCAAGCGATTCACAACGCTATTGCTGAAGCGACCGTCAGCACAAAGGAAGGCGTCAGTGCA
CCTTTGGTGTCCGAATTGGAGTCCGCAAAGAAGGCGTTGAAGTTTTTGTGGAGTGAGCCAGTACTTAGTGATAGTGAGTACGACGGACATCTTCCATGGT
ATCTTCGTTCTGTCCGAACTATCAGGAGAGAGCGGGAGGCGAACGAGGAAACGGTGTCAGCGCTTCGACAGGAGCTTGCAGCAAAAGAAGTGCAGAAAAA
AGAGGTGCTGGAGAAAAAGATGAAGTGGCAAGAGGCCAACAATTTGCTGCGTTTTGAGAAGGACACCTTACTGCGAGAGATGGATCTGCTCCGCCAAACG
TTGCAAAAAAAGAAAGAGCAAGAGCTTCAAGAGCTTCGTGCGGAGTATGATGTGCGCATCGAGCAGTTGAAGCAGCGACACGACCGATCAATTATGAAAT
CGGATCAGGATTATGAGGTACGGTCATTGTTACTATGAAGGCCTAACTTTTCTCCCCTCTCGCTAATCTCGCTAATCTCGGTGTATTGGGTTTTGGCAGA
CTGCGACGAATCAATTGAGGGATGTACTCGAAGCAGAGCGGCGAGCCACCAACCATGCCAAGAACGAGCTTGTTGAGCTGGTAAGATAGTGCGCACGATG
TTTTATTCTGCATCATTGATGGATGACACCACGTTCTTCCTACTTTTTGCAGAGAATGGCGTTAGAGCGAACAGAAGAAGAACTCAAGGAAGTACATCAA
AAACTTGACAAGGAGACGGATGAACTTCGCGAAGCGGTGAGAATTTGTACTTTTGCGCAGTTTTATTCAACGCCCTGCTGACTGCGAATTACCTCTTCAA
CATACAGGCAGGCAAGTGGAAGCGGAAAGCCAAACTGGCCATGAAGAACGCTGGCGGTGGGGGTTCGACGAAGGGAGCGCTGCGCATGTCGTCATCATCG
CACGGAACGGAGGAGGACTCGGACGCGTCGTACCGCATGATGTATCCGCAATCCCGACGAGCGTCCAACGCCATGACAGACTTGTCGAATCTGATGGAGC
AATCGCTTGTCAGCATCCGAAAAGAGGCTCTGGTGCCGCTGTCTCCACATCTTCAAAGATAGACAACATTCTGTAGTAAAGGCTATTTAGTCATTGTAAA
CAGCGCACACGTGCGTGTTTGCACAAATGTATTGATTTCATTTATTGCTGAAGCAGCTCCTGCTTCCACATAGCGAGCATCTTGCGCAGCTCCGGCTCCC
AGTCACTCACCACCTTCTTTGCGGCGAGTTCGCGCTGGCTGCTACCGTTGGTTGAGACGAGCACCTCATAGTCGTCGCCGCTCGTGTCGTCAAAGTCCTG
CAGCTCCACATGGCCCGATACATCGTCACTGCCCTCCCACGCGAACTTGACCGACAGTTCGTAGCCGCAGCGCTTTTTGCCGCGACTAAAGACGATCTTC
TCAAAGCACGAAATCTCAGCCACAAACCCCTCTTCAAAACACTTTTACCCACTCACCTTCGCTTCACCGTCACAACGCACAATGGACGTGGCCTTGATGG
ACAGTCCCTGCGCCTCGTCTTCGAAGCTGAAGGCCGTGAGGATGTGGTGTTTCAGTCGCTCACGAGCCCACTCGGACTTGTCGCGCTCCTCCCTGCAGAC
ACCAGTTAGAAAAACTCCTTCCCCGCCGACACCAACCAGTAACTCCGCAGCGCACCAAGTGCCTGCCGCATTCCACACGGAGCTGGAGTCGCTCCGATGC
ACGGGAGCCGTCACCGCCGCCGAATGGTCGATCCGCACAGGGGTGAAGTCCTGAATCCGCGGAATTCCAGCACCAAAAACAGCATTTTAGTCCCCATTTC
AGCAGTAAATTAATGCTACTACACCCGCACCTGCGACGTCTTGGGGATCGTCTTCATCCAGCCGTGGTACCCGCTGTGCATCTTGGGGGCGTCTTCCTCA
CCGCTCGACATCGTATCTGCTGGAATATTCGATAATGACGCCGCATTCACGTCTTTTCATCCAATCACCTACCTCCACTCTCCTCATTCGTTAAAAATCA
AATCATCATCTACCCATACATTAAAAAAGGTAGAGCGCCCTACCATGCCGGGTGTCTGGAGCGCGCACGTGACCAAGGAGGGCCGCACATACTTCTACAA
CCGCACCACGAAGCAAAGCGCGTGGGAGAAGCCCGAGGACTTTGACGGAGACGAACCCCCTGCCCCCTTTGGCGCCAAGAGGCTCGAGTGGGAGGAGCTC
TGGGACCCCAAGAACGAACGCGCCTATTACTACAACCGGGCGACGCGCAAGACCCAATGGCAGAAACCCGAGGGCGTGGAGATCAAGCCCCGCGCGGGAG
CGAGCGACAAGAAACACGACAAGCACCGAACCAAGGCCAGGAAGGGCGACGAGAACGGTTCTACCCCGCGGGAGAACGAGCCTACCGAGGCTGAGGAGAG
CAAGGCTAAAAGTAGTCGGGAGGAGAATCAGACGCAGAATCAGGCTGAAGATCCGAATCAGACTCGGAACGACGATGTTAATGCACAAGAAGCAGCGCCG
ACGTCGACGCATAGCAAGAAGAAGAAGAAAAAGTCCAAGAGGGACAAGGCGGACACTGCGGTGGTGGACACTCAGAGGAAACGGCGTCGACAGGATGAAA
AGCGACTCATTATTTGGGATGATGAGGAGCAGGGAGTGGATGTTACTCGGGGCATTGAGGAGAAGGATACGGAGGACGGCAAGGAAGCCACTAGATTGCT
ACAGGAGCTGTCCACGACGGACGCTATTATGGAAGCCAACGTGCTCTCGGTGATTAACGGGTTCTTGAGAGCTCATACCGAGTCCAATGGCCCGGAGATT
CTCGTGGAAAAGCTGTCGTCCTCGTACCGTGGCCATGCTCAGATGATCGGCCTCGTGGCGTCGTGGCTGGACACGCTGCCGGTTTCCACGACGGCGTTGG
AGAACAAGATGACGTTTGATGTGAACGAGGGAGCGGTGATCTCGAACAAGGGCGCGTCGTGGGACCCGGCCGAGGAGATTCTGTACAGTCATCTGAAGGA
CGTTATTAATGAGAACTACGACCCGAAACTCGTGTCGAATGTGCTGAGCGGGTCGGCGGTGGAACCCGAGTGGCTGACACAGATGCTGAACGATCGCAAG
TGGCGACTTATGCTGATTGAGTTGGCCGAAACACACAAGGTTTGTAGTGATCTTGTTGTGGAGTTGATGATGGCAGATGCTGACGGTGTCGCTTTCGTTT
TTTAGACATGCACGTTGCTGCAGTACGCGATCCGACGAATCTCAGAGGCTGGACACCACAAGGAAATTGCCTCTATCACGAGCGCGAATGCTTTCTTCCC
TGTGTTCGGCGGTGTGTTGGTAGACGCCTTCAGCCGAGTAAGTAAGGTCTTGCTCCTACGGCTTTAACCTTACGTAATCTAACTGACAATTGTCTCCCAC
AGATTCCATTTGCCAACGAAGAAGAAGTGGTGGAGGACATCACCGCACTCAACAAGATTTGCTGTCAGTCTTCGCACTCGTACGTCTATGCACAGGAGCT
CCTTTGTTCAATGGACGACAAGCTGTATTTG