Description :
From Genome Similarity Track
Location :
Scaffold_1288:3556- 5744
Transcript NameFunction/comments
g11534.t1hypothetical protein
g11535.t1hypothetical protein

Sequence
2188 bases(100 bases per row)
TTATGCCCGCCGGCATAGTGGGAAGTCTCATACCAATCCGGGGGACTGGGATGGGTACACACGGCGATAAAAGCCGGCCTAGCCGGGTCGTCCATCCTAG
CCCCGGGCTTGACACCGTGTAATGGGACCGGCCCATAGTGTGGTAACATGCTATTTGGGTTTCTGTGCAGTTACGGCTGTGGCGGACACTTTCCAATCAA
AAGGACGAGTCGGCACTATTGTGACAAGTGAGGACCGCTCGACGGTGGCCATTTGCAGTGGTACCGGTGGAAAACCGTTGGTTTGGTGCAGTCTGCGCTC
AAACTCGGGGTTTGTACGGCCCTTTAATGCCTATGATGCCTTGCTGCTAAAAAAATTATTAAAAAAGATTCCCAAAAAGCTGACACGTGTCCCTTTACAA
CCAAAACGGTTAATTGCCTGAGCTGATAAAGCTCAGTGGCATTGAGCGCGACCGGTAGACCTCCGTTGCCAAAGGAAGCAACCAAAAAAAAAGAAAACAA
AAAAATTGAGGTACCGAGTCGCGCTTCAGCACCTCGAACCCGCAGCTGTGTCTCCAAAGGTATTGAGACGCAGCACCAATGCGGGGGTGCTTTAAAGGGA
TAACGGTGGATGTGAGGGACCAGAAACAAACAAAAGCAAACGCGGCAAGGCTAATGAGGTGTTTTACAGCCGTGCAGGACTCGGGTTTGTGGCGAGGACT
GTGCAAGACTGGTGGTGCTACACGGGTATCCTGCAGGTGTGTCTCCAGAAGGCGTCTCCTTGCGAATTGCGAGGTACCGGCCGTCCTTTTACTAACGACT
GCAGTTTTGGGTGGTTGTTTTCCAATGCACGTGCGCATTTATTGGGAAGTCCACTAACGCTGCATTTGTTGTTGCAGTTGTTGCGGACAGCACCATGGTG
AATGTCGGCAGCAAGCGGGAGCGGTACGGCTGTTTCTTGGTTGTAGTCAAGTGTCCCTTGCTCAGTGGTCTCTTTTGTTAGTGATGAGCGGCGTCAGGAG
CTGGACCAGCGCCATACCCAGGCCCTCGATGCCAACGCGTCACCACAAGGATATGAGTCTCCAGCGTCTAAGAGGCGACGGTTGGGGCGCCGCCGCGCGG
CTCAAAGGCGGTTTCGGGTGGCAATGGAGCAGATGGAACAACTGAGCCTACAAGAGGCGGCCGCAGGTGGAGGGGACGTCGTCACAGTGACAACGGGTGA
AACCGCCCCTCCTGTGCCGACGGTCGTTGGACAAGGGGCGACTAGCCAGCTCTCTGCAGGTGCTCCAGTGCAGAGGGCGACTGACCCACAAGCAAATCCA
CGTCGGATGAGGGAGGCGCAGCGAGCGCGTTCCAGACGAAGTAACATGACCGACTCTCAGCGGGAGAGTGCGCGGCGGCGTGACGCGGAGCGAAAGCTAG
CCCGGCGAGCCCAGCTCCGTGCCGAGCAGCTTCAGGACGTACGAGAGCGAAACCGGATCGCACAGCAGGAACGTCGGCATAATCTGAACGAAGAGGTCCA
CGCTGCGGAGCGTGAACGCAACAGTGCTTCTCGCGCGCTTCACAGGAGTGTACAGGATCGCACTGAAGAGCGCAGAACAGATCGTGAGCAACACGCGGAG
CGCCGGTCTCAGCTCACGCAGGAGGAGCGTACCGAAGAACGGTTGGTAAATCAAGAGCAACACGCGGAGCGCAGATCACATCTCACACAGGAGGAGCGTG
CCGAGGAGCGGATAGTAAACCAAGAGCAACACGCGGAGCGCCGTTCTCAGCTTACACACGAGGAGCGCGCTGAAGAACGCATGGTAAACCAAGAGCAACA
TGCCCAGCGCCGATCACAGCTTACGCAGGAGGAGCGTGCTGAAGCGCGAAGGGTAAACCAAGAGCAACACGCGGAGCGCAGATCACAGCTTACGCAGGAG
GAACGCGCCGAAGAACGCATGGTAAACCAAGAACAACATGCGGAACGCCGCAGAGAACAGACTGAGGAAGAAGCACTTGAGCAACGCGAGAGAGAGCGAT
TTCGGCGTAGATCGGCTCGACGTGGAGAGGCGTTGGCAAACCACGACGATTTTGACGTGGCCTACGTCCAGGGTCCAGACGTTGTGAATGGGCGCCATCG
GCTTCCTCCCACCACTGTTTGTGAACATTGTGGCGCTTGGAAGTGGCCTGGCGAATCAAAAATGAGCTGTTGTCTGGAAGACAAGGTT