Description :
From Genome Similarity Track
Location :
contig_38:355448- 363787
Transcript NameFunction/comments
g8388.t1XP_008911523.1 hypothetical protein PPTG_16025 [Phytophthora parasitica INRA-310
g8389.t1hypothetical protein

Sequence
8339 bases(100 bases per row)
CCAAACATGGAGAGGCGTGAAGGCTCTTTCACAAAACTGTTTGGAATAAGCTCGTCGAATTCCTTTGTCGTGAATGGTTCTGCAAAAGACAGAGTACCGT
GGTTAGCACCCACAAGTCACGAAAGGAGCTACCGGTAACAAAGCTAATGAAGCATTATCAAACCTTCGAGTGGGAACTCAAAACCAAAAGCAAGCACATT
AGGAGGAGTTCCGCTGGGAGGGTGGTTAATCTTGTGCGCCACAGCAAGAGGATTGCTCGGCTTGGAGGCTGGATGGACATTCAAATTCTGTCAGTTGTGC
TCTGGGGGAAGAGAACGGATCCACTGTTGCAATATAAGCACTCTGTCACGACTGGCACGCACATTCGTTCTTGGCGTCAATAATCACACTATCGAAGCGG
GCTCGAGCGAATGGGTTGTTTGACAACTCGCTCAGGTATTGTTTCTAACACAAGGGAAAAGTTAGATTTAAAGCACCCATGGTCCAGCTAATATCCCAGC
AGCTTCACCTTTTTGTAGTGTTCAGGTAAGTAAACAATGCCCGGGTACAGTGCCTGTTACACCCAAGCCGTGCATAGCATAAGATAACACAGCACAACAT
CAAAAGTGTAGCTAACCAGTAGCAATTTCGTACCACTAGGGACCCGATGGAAGCAGCACCGCGAAGTTTAACGCCTTCCCCCGCATCAGGAACGCTTGAT
TCTTCCACGTTCAAAGTGAATCCGAACAGCTTCTGGAAGTCGCCAGTGATTCCAAGCTAGGCCGGTAACACGCGGGTGAGCCAACTCATCATCCCAGCAA
AGGGTTATTGACACCTTTCGCACCTTCTCGCCCACTTCAGTGTTGCGCTCGAAACCTGACAACGACATCTTAGGCGCGTTCTTCTCCGACTCCTTAGGCA
TCCGCAGCACAGCGTTAAAGCAGCTCTGGACCTGTTGACAATAGATATAGCCTGCGATTCAGCACAGATTTTGCTGCAGTCCAGCTACGTTATCTACACC
CACGCACCTGCTTGCTGAGTTCATCTTGCACATACTGCTTCTGCTGTTCGAACTTCTTCTTGCCTACGATCTCCACGGCTTGGTCGAACAGTTCCCCATG
CTCTCTGCACAGAGCACACGAGATTAATATAATCCAAGTCATCTGTGCACAATTGCAGCATTAGAGCGCAACTCACTTGTCCGCATTCTGCGGGTCCAGC
TTCAAGCTCCGGAAGCAGCTCAGCACCGCGGCCACGCCCACGTCCGCCTCCTCCTGCTCATAACAACGTTAATTAAAACCAACAGTTCGTCCCTGTAATG
CTCTTAACACACTACAACGCGATGCAACGCACCTGGAAGCGCCGCGCCGGCGTGGTGCCCGCGATTCGGAGCTGCAGTCGGCGCCACACGCTCGTCATTT
CGTTTTTGCACATACTATGGCGTATGCGAGGCTTAGGCTATACAATGGGCTGGCCAAAAGTGCGGCGCAAAATCACACCTGAAAATTGGCTAGAGGGAGT
GATGGCGAGCACAACAGCAGCGAGACGCCCAAGCCTGCGGCCGAGGACCCACCTCACCCGTGGGGCCCGCGCATGCGTATCGGCAAGGTCTTCCTCAAGG
GCAACGATCGCACCAAGTACGCGCGACTCGTGATTGATGATGGTGGTATCCAATCAAGCCTGACAATTGGGTTCTGTTTCGTGTGAGTACAGGCCGGAGG
TATTCGAGAACGAACTCCAGGTACAACTAAGTCATGCAACAGTTGATAGTATATATATCTACTGGTGCGAGGATCTGACAGACACGGCGTACTCAATCTG
TAGGCGGCGTACAGCGCCGAACGGATCGGCCAGTTGGTGCACAAGCTGGAGGAGGCCACGGAGGAGTTCAGGGCGCTCGACATTTTCGAGTCCATCAACA
TTGAGCTGGACAAGGGTGAGGACGTGTATTCAGGGTGGCTGCGGATTGACGAGCTAGATTTTGACGTGGTGGTTTGATGCGGTTGCTGCAATCACAGCGA
GCTCTGGCCAGCTCGATGAGACGGACCTGACGATCACGGTGAAGGAGAAGGGCTGGCGATCTCTGCACGTGGGCGCAACCACCGACGGCAACGACGAAGC
AGGAGTACGGTGCATTTAATTAAAGAATCGGCGCGTAGAGATGGACTGCTAACAGATGATGCTCTTTGTTTGCAGGAATCTTCGCTCACGTTGTCGAATG
CCCTCGGTGAAGCAGAGAAGATCACGCTTAGTGCCACTTATGCGCGATCGGGCAGTAACACCCAGCGCGCGACGTTCAAGAAGCCGCGCTTTTTTGGTCT
ACCGCTGTACCTGAGCGCCGTTGGCACCAACGAGCTCCACGTCAGTAAAATTGCTGTGCTACTGGATTTGTTGCAGACTATGTCGTCTGATTTTACGGGG
TATTGCTTTTTCAGAACCAAGAGTGGCTGAGCTCGTACAACGAGAAGATTCGTGCTGGTAGCATTTCGATCAGCGACTATGAAGGTGTGCACGACCTGTC
ATGAATGTGGGTTGGCGCGACCTGCTTCCGCGCCGAGACTCCAAGATTCCGACTGCGTACCGTGCGTCACCGAGTATCCTGGCGGAAGCAATGCCGTCCA
CGAAGACCAGTGTGAAATATGTGTTCACGGACGACAAACGGAACAACGTTGTGTATCCGACAGCTGGAGGCCTCTTCAAGTACACGTACGTGACTTGGCA
ACAGATCCATTGCACTTGCAGCAAAGGTTCAGCTGATCTAACAAGTTGTCTGCTTGGTGCTTCTTAGTACGGAGATTGCTGGTCTTGTGGGCGATGTGAA
GTTCGTGAAGGCTGAGGTGGAGGGTCAGAAGCACGTTGCGCTGGGCCCTGTTCTCAATGGATTCCCGATCCTTAACTTCAGCCTTTCGTACCACTTGGGA
ACGGTGAAGTCGTATGGTAGTGAGCAGAACCGGCCAGCACGCATCAGTGACCGCTTTTTCCTGGGTGGCCCCATGAATGTGCGTGGCTTCAACCACAAGG
GCATTGGTCCTCGGGCTTCTCCTCTTGATGGCGGGGTTGCGCAAGGTGATGCGCTTGGTGGCGACGTGAGCTACAACGGAACTGCAAGCCTCGGCTTCCC
TGTTCCTTTGCCGCTCTTTGTTGTAAGTCTGTCTTGCATGAACCAATAACTTTGTCCGTCTAATTCACACTATCTTCGTGTGCTTTGATGCTCAGGCGCT
GGGTCTCCGCGGACAGTTTTTTGCTAACGCTGGCAATCTAACGACGTGGGACCGCCTGCTTGATGAGAAGAAGTGGCTGAAGAACCTTACGGACGACACG
CGTGTTTCCGTGGGCATGGGTCTTGTATGGGGAACCCGCATCGGCCGCCTCGAGGCCAACTACTCGTGGATTCTCAAGGCGCACGCTCATGTAAGCTCTC
GCTTTTCTCTCTCTGGCAATTTGATGTTGACTAATTTTCGCTACTGTCACGCAGGATAACATCAAGCGCGCCCAGCTTGGTCTCGGCATGACCTTTTGCT
AACCGTAGAGAGTAAAGGCAAAGTAAGGAGGGAGGGTTGACGAAATACACTGGCAGCATCAGCTCCCAATCCACTACATGTAGTCGCTACCATGACGAAT
TATTAATAAGGGGCTAGTTACGATTGACCCCTAATTCGACTCTCTTTTAGACTGGATGATGCTCCAAGGAACCTACTGACCAGAACCCAGGCCACTCACT
GAGATCTGCCGCATCGGGAAGAGAAGGTCTCCACTTCCAGTCTCTTCATCTCTCAAGCAACAGCGCCATGTACTCGGGCAACGCGCGCGCATCTACAACC
CGCAGCCGGATCCGCTGGAGCGCGGGCCGCCCAAACGCGTGCTGCGCGAAGAGCAGCACATCGGCGAGATGGTGGCGGCCTCCAAGAAGCGCGTGACGTG
GCGGTTCACGCTGGGCGACTCGGACCGCACGCACGAGGTGGTGCTGGTCCACTCAGTCATGAGCTACAAGAAGGTGCGACTTCTGTGGCTGGTTAGGCGC
TACTTGAAGTGGATGACTGATGGGGAAGCGCTTTGGTGGTGCAGGTGGTGCAGTATGACGGCCGACAGATGCATTTCTCGTCCACGGTGAGGAGATAATT
TTTGATCATGTTTGGGGGATTTGGTTTTTATCGTGATGTGTGGTGATTTGTTGTGCTGTCGTTCGTGTAGGCGACGTTGGGCGACTGGAGCTTCTCAATG
GTTTTGGACGGACTCAATGTGGTTATGGAAGTTCGTATCAACGACATGGAGTCTGCTGACGTCCCGAAATATGGTGTGGTTGGACTTTCGCCACGTGCAA
GGAGGACGAGCTAATCAGGATGTACCTGCGTGTGTTATGTGTCATGCTAGACTTCGTGATTGATCGGATCCCGTTCCGTCGCTGGGATGTCTATCGCCGC
AAGAAGCACGGGATCACTACCGCTACCTATGCCCAGCCGAACGCTCCTTCCGGAAGTACGTTACGGGCGTATATATTCACAGCGTTATATTTTTTTAATG
ATAGGCATTGTTGACGTGTGATCAATGTTGTGTGTCAATTAGATGCGTACGGAACGCGCCGGTGGGGGCCTGGCGGAGCGACGCAAAACGAGTCTCAGTC
GTCTCACGGCTCCTTCACGAGTAGCAATCGCGAATCTTTTACCGGTAGCTCTCGAGGATCCTTCACGGGTAGTTCTCCTCCGCCGGATCGTACGCAAAGC
TTTGGACAGCAGGGTGCTCGTCCGCGAACGTCTTCGGGACAGCAGAATGGACGCACTCGCAGCTTTTCGGGACAGCAAAATGAACAGCAAGGGTTTCAGC
AGTACGGTGGACAGCGCTCATCGTTGCAGGAGCAGAGTGCACCGTTTGCTCCTAACCCTGCGCCTACGAACGCGCACCGTCAGCCACCCCCGGCCCCGGC
TGCACCAAAGCCGAAGAAGCAGCCCGAGATTAATTTGATCGACGACTTTGGCCCCAGCGTGAGCGTGTCGGCACAATCGTTGATTTTCGATCCTTTGGCC
AGTGTAAGTGCAGTTTCACATGAGTATTCGTTTGCACAGCGATGATATATCTCACATCATAATGTTGTGAATCCTAGGCAAAGATCTCAGCGGCTGGAGA
CTCTGTTGCCACAAGCGTACCCGCGCCGCACCAACAGCAACAAGCAGTCCCAGTCGCTTCTATCCCTCAGCAAACCAACTATGTGGACCCGTTTGCTTCT
GTCGCTCCACCCACACCGACGAAGCCCGCCGGAAACGTCAATTTGGATCCGTTCGCAACTCACAATACCGGCAACTTCCAACATCAACAGCAGCAGCGCC
CAACTTCTATGGGTAATATGACTCAAGCATACACGCAGCAACCTATGGGTATGGCTATGGGTGCGCCTCAGGGTGGAGTGCTGATGCAACAATCTCACCA
GCATGGAATGCGAGGTTCTTTTACAGGGCCGCAGCCCGGTGCTCCCAGTGGCATGGGCAACGTCAACTACAACATTTCGCAACTCATGAACCCGGCAAGC
CTCCAAAACGGTCAGCAGAATCAGCAGGGCAAGTCCATTAACATTGATGCGTTCGCTAGCTTGGGCCGTTAGTGCCAAGCGGCTAACAAGCGATGCACAG
ACGCATATTTTGATGAAGCACCTTTGTTCCTATCGCGTAATATTCGTACGACGTCGATGTTTACCATTGCCAAGCAGTTCACGTGTTTCCCGATCTATCT
GGCTTGTCATCTGGAGCCTCATCTGTACACGGACATACTCAACCTCAGCTTGCTTCTTGGCCTCGAGATTTTCTTTCACCATTTCAAGGCGCTGGGCATG
CTCCAGCTCGATGAGCTCGAGCTGTCGTGCGTACTGGGCTGAAAGTACCTGCACGTGGTCCTGCAATCGTTTGTCTGCTTGTACGGTCCACTGCTTCTCC
TTCAGTTTGATCTCGGCGGTGTGGAACGACTGCAGCTCGTTCGTGCGTTTTGTTAAGGTCGCCGGGGCACTCTTCGCTAGCTTACGCGCGGCCGCGATCA
CCTGGTCGCACATTACCAGATGATGTTGCAATTCTTGCTTGCACGCGTCCAGTTCGGCTTGGAACTGCTCAGCCTTGCACGCGGCGTCGTGGTGGTACAG
GAAAACACTGCGCAGCTCGAGCTCCACTTTGCCGAGCAAGCGATCCAAGTTGGCTCGAAGCACGGCAAAGCCCTCGAGCTCTTCGAAGTCCCGGAAATGC
ACCCGCACGCGATCCTGCGCTCGCAGGAAGAGCTGCTCCTCTACGAGCGTCAATCGCACGCTCTGTTGCACTTGCATCCCGCGGGCTGAATCACGCGTGA
CACAGTAACGATTCCCGCGACCGCCGGTTATGAACCGTTATTTCAAGTGCACATGAAAGCCGAAAATGAACGTGTGCTTCAGGTGACAGAAATCGGCTAT
GGCCTCTATTGGAATAATTTACACCGCGCAGCAGGTGCGCTGCGACTTGTTCGGTGGAGCGCTGTAGTCGTCGCGCGCCTTCTAGTTTACTGTACGCCAC
ATCCAGTGTCGTTGGTGCTCCAACGCATGGCCGACGTGTAATTGCGCGTGGCCTTCTCGAGCGCGATGAGGTGCGGGTCGCGGACCTGTAGAGAGCGCAT
GCAGTCGCAGAGCTTGAAGAGGTACTCGAAGTTGGGGCCGCTGAAGCCGCTGCGGGTGGCGATCTCCTTGGCCATCTCGTCCACAGACGACGGTCCCAGG
AAGTCCGAGTTGGTGGGCGTGGCGATGTACACGAGCGCTTTACGCACCACGCCGTCCTCGCAATGGACATCGACCATTTGGCGGTCGTAGCCGGCCTGCT
CGCGGTTGTCGAGCTTGGTGAGTGTGTCGGCAACCTCCTCGTCCGGCACCTTGTAAAGGCGGCCCCACGTGATGTGGTCGCCCGCCAGGTGCGCGTACTC
GTCGTCGAACTTCTTCATCTCCTCGCGGCTGATGAGCGTCACGACGCGGCCCTTTGCCTCGGGCGAGCCGCGGTGGTCCGGGCTGCCCTGCCAGAAGCGG
CGGTGCCAGCCTTCGACGTAGCCGAACACCGTGTCCTCCGCGGGGAACTCAGTCTTCCAGACAATCGATCCGTAGCCAAAGACCCACATGGTTTCTAAAT
AGGAGCGGAGGTCTTGAAGACTAGTAGCTGCTGCTTGATGTTGCCGCGATGGAGGCGAATTCCAGAATGAGCTCGGTGGCAAACAAACGCCCAGCCGGGT
TGCCCTATCCTGGGCCAGGATTACTTGCCCTACCCACACCGTTCGGTTGTTTGAGCAAAAAGCTGCCTCAAGAAAATTCCGCCTTGCTGAGCCTGTGACG
CGGTAAATCCCGGGAAATCTGAGCGAGCGCGGCCCCAGTAAAAACGCACCGGGGGGCATCCTGCGCAGGACCCCGATAGCCGCAGCAGAGTGACCTGCAG
TCTCGTGCAAGTACCGCAAGACAGCATGTTTATCCGCTCATATTGAGCTCGAGCTCGAGCTGGCCGTTGTGGTCAAAGATATCCACCGGCAGGCAACTCA
GGATTGAATCCTGGCTCTGCAGGCAGCAGTGAGGGCCACTCATACCGAGACGCCATCCGTATCATTTGCCGCAGGACAGCCGCGCCGATCTGCTCGGGCG
AAGAGAAGCGGAGGCGTGACCGGATTGGGCCACGTGCATCGAGAGCGTCCTGCCAGCGAGTGACGTGCACGGCCGACGTTGTGCCAGCCCGGTGCTGTCA
AAGTCGGTTTTTTTGCCGGAGCGACGCTTGTTTATGCCTCAACTGTCCTGCTCTGTCCAGTAACGTTTCGGCGACCAATGAGAGAGGCGTATCTTGATGA
CTAGAGGTGCACCTTCACCTTATTTGATCGTACTTAAGAGCGTGGTGGTACCTCTCACGCTGATTGGACATTCCGCTTAGGTACGGTTGGCCAGTGTTCC
ACCTCCCCATCCCCCCTTCAACACCAGAATTGGTGACGATCTCATGGCGGTCACCAACGGAGCCCGAGCGCCGGCGCTGATAGGCCCCCCGCTGGTGCAG
AAGACCCGATTGGCGACCCCGTGCCGCCGTCACACCCGGATGGACCTCAAGCAGCCGTCGCGTGGTTGTCGCCGCGCTCTTGGTCACTGGAGCGTTAGCG
GTACAGCCGATCAAGCAAGCCTGCAAGTCGAGGAGGAAGCCGGGCGCGGCGACGCGCAGCGCAGGGCGGTTGACTGCCTTCGTTGACGAAACACGCTGAT
CGAAGAAGACCTCCGACACGCAGTTGCCGACACGCGGTTGCCGCGCTCGCGAAAGAAAATCTGTCAGCGAGGCGAGGACGGTGCAGTCGAGCGGTCGCGG
TCACGGTCACGAAGTCTGCCACTGTGTAGCACTGCTACA