Description :
From Genome Similarity Track
Location :
contig_38:355404- 363743
Transcript NameFunction/comments
g8776.t1hypothetical protein
g8777.t1hypothetical protein
g8778.t1hypothetical protein
g8779.t1GAY03660.1 sorting and assembly machinery component 50 [Pythium insidiosum
g8780.t1hypothetical protein

Sequence
8339 bases(100 bases per row)
TTTTTTCTGAAAGGAACTTACATGCACGATTGCACGTTTGCCAAACATGGAGAGGCGTGAAGGCTCTTTCACAAAACTGTTTGGAATAAGCTCGTCGAAT
TCCTTTGTCGTGAATGGTTCTGCAAAAGACAGAGTACCGTGGTTAGCACCCACAAGTCACGAAAGGAGCTACCGGTAACAAAGCTAATGAAGCATTATCA
AACCTTCGAGTGGGAACTCAAAACCAAAAGCAAGCACATTAGGAGGAGTTCCGCTGGGAGGGTGGTTAATCTTGTGCGCCACAGCAAGAGGATTGCTCGG
CTTGGAGGCTGGATGGACATTCAAATTCTGTCAGTTGTGCTCTGAGGGAAGAGAACGGATCCACTGTTGCAATATAAGCACTCTGTCACGACTGGCACGC
ACATTCGTTCTTGGCGTCAATAATCACACTATCGAAGCGGGCTCGAGCGAATGGGTTGTTTGACAACTCGCTCAGGTATTGTTTCTAACACAAGGGAAAA
GTTAGATTTAAAGCACCGATGGTCCAGCTAATATCCCAGCAGCTTCACCTTTTTGTAGTGTTCAGGTAAGTAAACAATGCCCGGGTACAGTGCCTGTTAC
ACCCAAGCCGTGCATAGCATAAGATAACACAGCACAACATCAAAAGTGTAGCTAACCAGTAGCAATTTCGTACCACTAGGGACCCGATGGAAGCAGCACC
GCGAAGTTTAACGCCTTCCCCCGCATCAGGAACGCTTGATTCTTCCACGTTCAAAGTGAATCCGAACAGCTTCTGGAAGTCGCCAGTGATTCCAAGCTAG
GCCGGTAACACGCGGGTGAGCCAACTCATCATCCCAGCAAAGGGTTATTGACACCTTTCGCACCTTCTCGCCCACTTCAGTGTTGCGCTCGAAACCTGAC
AACGACATCTTAGGCGCGTTCTTCTCCGACTCCTTAGGCATCCGCAGCACAGCGTTAAAGCAGCTCTGGACCTGTTGACAATAGATATAGCCTGCGATTC
AGCACAGATTTTGCTGCAGTCCAGCTACGTTATCTACACCCACGCACCTGCTTGCTGAGTTCATCTTGCACATACTGCTTCTGCTGTTCGAACTTCTTCT
TGCCTACGATCTCCACGGCTTGGTCGAACAGCTCCCCATGCTCTCTGCACAGAGCGCACGAGATTAATATAATCCAAGTCATCTGTGCACAATTGCAGCA
TTAGAGCGCAACTCACTTGTCCGCATTCTGCGGGTCCAGCTTCAAGCTCCGGAAGCAGCTCAGCACCGCGGCCACGCCCACGTCCGCCTCCTCCTGCTCA
TAACAACGTTAATTAAAACCAACAGTTCGTCCCTGTAATGCTCTTAACACACTACAACGCGATGCAACGCACCTGGAAGCGCCGCGCCGGCGTGGTGCCC
GCGATTCGGAGCTGCAGTCGGCGCCACACGCTTGTCATTTCGTTTTTGCACATACTATGGCGTATGCGAGGCTTAGGCTATACAATGGGCTGGCCAAAAG
TGCGGCGCAAAATCACACCTGAAAATTGGCTAGAGGGAGTGATGGCGACCACAACAGCAGCGAGACGCCCAAGCCTGCGGCCGAGGACCCACCTCACCCG
TGGGGCCCGCGCATGCGTATCGGCAAGGTCTTCCTCAAGGGCAACGATCGCACCAAGTACGCGCGACTCGTGATTGATGATGGTGGTATCCAATCAAGCC
TGACAATTGGGTTCTGTTTCGTGTGAGTACAGGCCGGAGGTATTCGAGAACGAACTCCAGGTACAACTAAGTCATGCAACAGTTGATAGTATATATATCT
ACTGGTGCGAGGATCTGACAGACACGGCGTACTCAATCTGTAGGCGGCGTACAGCGCCGAACGGATCGGCCAGTTGGTGCACAAGCTGGAGGAGGCCACG
GAGGAGTTCAGGGCGCTCGACATTTTCGAGTCCATCAACATTGAGCTGGACAAGGGTGAGGACGTGTATTCAGGGTGGCTGCGGATTGACGAGCTAGATT
TTGACGTGGTGGTTTGATGCGGTTGCTGCAATCACAGCGAGCTCTGGCCAGCTCGATGAGACGGACCTGACGATCACGGTGAAGGAGAAGGGCTGGCGAT
CTCTGCACGTGGGCGCAACCACCGACGGCAACGACGAAGCAGGAGTACGGTGCATTTAATTAAAGAATCGGCGCGTAGAGATGGACTGCTAACAGATGAT
GCTCTTTGTTTGCAGGAATCTTCGCTCACGTTGTTGAATGCCCTCGGTGAAGCAGAGAAGATCACGCTTAGTGCCACTTATGCGCGATCGGGCAGTAACA
CCCAGCGCGCGACGTTCAAGAAGCCGCGCTTTTTTGGTCTACCGCTGTACCTGAGCGCCGTTGGCACCAACGAGCTCCACGTCAGTAAAATTGCTGTGCT
ACTGGATTTGTTGCAGACTATGTCGTCTGATTTTACGGGGTATTGCTTTTTCAGAACCAAGAGTGGCTGAGCTCGTACAACGAGAAGATTCGTGCTGGTA
GCATTTCGATCAGCGACTATGAAGGTGTGCACGACCTGTCATGAATGTGGGTTGGCGCGACCTGCTTCCGCGCCGAGACTCCAAGATTCCGACTGCGTAC
CGTGCGTCACCGAGTATCCTGGCGGAAGCAATGCCGTCCACGAAGACCAGTGTGAAATATGTGTTCACGGACGACAAACGGAACAACGTTGTGTATCCGA
CAGCTGGAGGCCTCTTCAAGTACACGTACGTGACTTGGCAACAGATCCATTGCACTTGCAGCAAAGGTTCAGCTGATCTAACAAGTTGTCTGCTTGGTGC
TTCTTAGTACGGAGATTGCTGGTCTTGTGGGCGATGTGAAGTTCGTGAAGGCTGAGGTGGAGGGTCAGAAGCACGTTGCGCTGGGCCCTGTTCTCAATGG
ATTCCCGATCCTTAACTTCAGCCTTTCGTACCACTTGGGAACGGTGAAGTCGTATGGTAGTGAGCAGAACCGGCCAGCACGCATCAGTGACCGCTTTTTC
CTGGGTGGCCCCATGAATGTGCGTGGCTTCAACCACAAGGGCATTGGTCCTCGGGCTTCTCCTCTTGATGGCGGGGTTGCGCAAGGTGATGCGCTTGGTG
GCGACGTGAGCTACAACGGAACTGCAAGCCTCGGCTTCCCTGTTCCTTTGCCGCTCTTTGTTGTAAGTCTGTCTTGCATGAACCAATAACTTTGTCCGTC
TAATTCACACTATCTTCGTGTGCTTTGATGCTCAGGCGCTGGGTCTCCGCGGACAGTTTTTTGCTAACGCTGGCAATCTAACGACGTGGGACCGCCTGCT
TGATGAGAAGAAGTGGCTGAAGAACCTTACGGACGACACGCGTGTTTCCGTGGGCATGGGTCTTGTATGGGGAACCCGCATCGGCCGCCTCGAGGCCAAC
TACTCGTGGATTCTCAAGGCGCACGCTCATGTAAGCTCTCGCTTTTCTCTCTCTGGCAATTTGATGTTGACTAATTTTCGCTACTGTCACGCAGGATAAC
ATCAAGCGCGCCCAGCTTGGTCTCGGCATGACCTTTTGCTAACCGTAGAGAGTAAAGGCAAAGTAAGGAGGGAGGGTTGACGAAATACACTGGCAGCATC
AGCTCCCAATCCACTACATGTAGTCGCTACCATGACGAATTATTAATAAGGGGCTAGTTACGATTGACCCCTAATTCGACTCTCTTTTAGACTGGATGAT
GCTCCAAGGAACCTACTGACCAGAACCCAGGCCACTCACTGAGATCTGCCGCATCGGGAAGAGAAGGTCTCCACTTCCAGTCTCTTCATCTCTCAAGCAG
CAGCGCCATGTACTCGGGCAACGCGCGCGCATCTACAACCCGCAGCCGGATCCGCTGGAGCGCGGGCCGCCCAAACGCGTGCTGCGCGAAGAGCAGCACA
TCGGCGAGATGGTGGCGGCCTCCAAGAAGCGCGTGACGTGGCGGTTCACGCTGGGCGACTCGGACCGCACGCACGAGGTGGTGCTGGTCCACTCAGTCAT
GAGCTACAAGAAGGTGCGACTTCTGTGGCTGGTTAGGCGCTACTTGAAGTGGATGACTGATGGGGAAGCGCTTTGGTGGTGCAGGTGGTGCAGTATGACG
GCCGACAGATGCATTTCTCGTCCACGGTGAGGAGATAATTTTTGATCATGTTTGGGGGATTTGGTTTTTATCGTGATGTGTGGTGATTTGTTGTGCTGTC
GTTCGTGTAGGCGACGTTGGGCGACTGGAGCTTCTCAATGGTTTTGGACGGACTCAATGTGGTTATGGAAGTTCGTATCAACGACATGGAGTCTGCTGAC
GTCCCGAAATATGGTGTGGTTGGACTTTCGCCACGTGCAAGGAGGACGAGCTAATCAGGATGTACCTGCGTGTGTTATGTGTCATGCTAGACTTCGTGAT
TGATCGGATCCCGTTCCGTCGCTGGGATGTCTATCGCCGCAAGAAGCACGGGATCACTACCGCTACCTATGCCCAGCCGAACGCTCCTTCTGGAAGTACG
TTACGGGCGTATATATTCACAGCGTTATATTTTTTTAATGATAGGCATTGTTGACGTGTGATCAATGTTGTGTGTCAATTAGATGCGTACGGAACGCGCC
GGTGGGGGCCTGGCGGAGCGACGCAAAACGAGTCTCAGTCGTCTCACGGCTCCTTCACGAGTAGCAATCGCGAATCTTTTACCGGTAGCTCTCGAGGATC
CTTCACGGGTAGTTCTCCTCCGCCGGATCGTACGCAAAGCTTTGGACAGCAGGGTGCTCGTCCGCGAACGTCTTCGGGACAGCAGAATGGACGCACTCGC
AGCTTTTCGGGACAGCAAAATGAACAGCAAGGGTTTCAGCAGTACGGTGGACAGCGCTCATCGTTGCAGGAGCAGAGTGCACCGTTTGCTCCTAACCCAG
CGCCTACGAACGCGCACCGTCAGCCACCCCCGGCCCCGGCTGCACCAAAGCCGAAGAAGCAGCCCGAGATTAATTTGATCGACGACTTTGGCCCCAGCGT
GAGCGTGTCGGCACAATCGTTGATTTTCGATCCTTTGGCCAGTGTAAGTGCAGTTTCACATGAGTATTCGTTTGCACAGCGATGATATATCTCACATCAT
AATGTTGTGAATCCTAGGCAAAGATCTCAGCGGCTGGAGACTCTGTTGCCACAAGCGTACCCGCGCCGCACCAACAGCAACAAGCAGTCCCAGTCGCTTC
TATCCCTCAGCAAACCAACTATGTGGACCCGTTTGCTTCTGTCGCTCCACCCACACCGACGAAGCCCGCCGGAAACGTCAATTTGGATCCGTTCGCAACG
CACAATACCGGCAACTTCCAACATCAACAACAGCAGCGCCCAACTTCTATGGGTAATATGACTCAAGCATACACGCAGCAACCTATGGGTATGGCTATGG
GTGCGCCTCAGGGTGGAGTGCTGATGCAACAATCTCACCAGCATGGAATGCGAGGTTCTTTTACAGGGCCGCAGCCCGGTGCTCCCAGTGGCATGGGCAA
CGTCAACTACAACATTTCGCAACTCATGAACCCGGCAAGCCTCCAAAACGGTCAGCAGAATCAGCAGGGCAAGTCCATTAACATTGATGCGTTCGCTAGC
TTGGGCCGTTAGTGCCAAGCGGCTAACAAGCGATGCACAGACGCATATTTTGATGAAGCACCTTTGTTCCTATCGCGTAATATTCGTACGGCGTCGATGT
TTACCATTGCCAAGCAGTTCACGTGTTTCCCGATCTATCTGGCTTGTCATCTGGAGCCTCATCTGTACACGGACATACTCAACCTCAGCTTGCTTCTTGG
CCTCGAGATTTTCTTTCACCATTTCAAGGCGCTGGGCATGCTCCAGCTCGATGAGCTCGAGCTGTCGTGCGTACTGGGCTGAAAGTACCTGCACGTGGTC
CTGCAATCGTTTGTCTGCTTGTACGGTCCACTGCTTCTCCTTCAGTTTGATCTCGGCGGTGTGGAACGACTGCAGCTCGTTCGTGCGTTTTGTTAAGGTC
GCCGGGGCACTCTTCGCTAGCTTACGCGCGGCCGCGATCACCTGGTCGCACATTACCAGATGATGTTGCAATTCTTGCTTGCACGCGTCCAGTTCGGCTT
GGAACTGCTCAGCCTTGCACGCGGCGTCGTGGTGGTACAGGAAAACACTGCGCAGCTCGAGCTCCACTTTGCCGAGCAAGCGATCCAAGTTGGCTCGAAG
CACGGCAAAGCCCTCGAGCTCTTCGAAGTCCCGGAAATGCACCCGCACGCGACCCTGCGCTCGCAGGAAGAGCTGCTCCTCTACGAGCGTCAATCGCACG
CTCTGTTGCACTTGCATCCCGCGGGCTGAATCACGCGTGACACAGTAACGATTCCCGCGACCGCCGGTTATGAACCGTTATTTCAAGTGCACATGAAAGC
CGAAAATGAACGTGTGCTTCAGGTGACAGAAATCGGCTATGGCCTCTATTGGAATAATTTACACCGCGCAGCAGGTGCGCTGCGACTTGTTCGGTGGAGC
GCTGTAGTCGTCGCGCGCCTTCTAGTTTACTGTACGCCACATCCAGTGTCGTTGGTGCTCCAACGCATGGCCGACGTGTAATTGCGCGTGGCCTTCTCGA
GCGCGATGAGGTGCGGGTCGCGGACCTGTAGAGAGCGCATGCAGTCGCAGAGCTTGAAGAGGTACTCGAAGTTGGGGCCGCTGAAGCCGCTGCGGGTGGC
GATCTCCTTGGCCATCTCATCCACAGACGACGGTCCCAGGAAGTCCGAGTTGGTGGGCGTGGCGATGTACACGAGCGCTTTACGCACCACGCCGTCCTCG
CAATGGACATCGACCATTTGGCGGTCGTAGCCGGCCTGCTCGCGGTTGTCGAGCTTGGTGAGTGTGTCGGCAACCTCCTCGTCCGGCACCTTGTAAAGGC
GGCCCCACGTGATGTGGTCGCCCGCCAGGTGCGCGTACTCGTCGTCGAACTTCTTCATCTCCTCGCGGCTGATGAGCGTCACGACGCGGCCCTTTGCCTC
GGGCGAGCCGCGGTGGTCCGGGCTGCCCTGCCAGAAGCGGCGGTGCCAGCCTTCGACGTAGCCGAACACCGTGTCCTCCGCGGGGAACTCAGTCTTCCAG
ACAATCGATCCGTAGCCAAAGACCCACATGGTTTCTAAATAGGAGCGGAGGTCTTGAAGACTAGTAGCTGCTGCTTGATGTTGCCGCGATGGAGGCGAAT
TCCAGAATGAGCTCGGTGGCAAACAAACGCCCAGCCGGGTTGCCCTATCCTGGGCCAGGATTACTTGCCCTACCCACACCGTTCGGTTGTTTGAGCAAAA
AGCTGCCTCAAGAAAATTCCGCCTTGCTGAGCCTGTGACGCGGTAAATCATGGGAAATCTGTGCGAGCGCGGCCCCAGTAAAAACGCACCGGGGGGCATC
CTGCGCAGGACCCCGATAGCCGCAGCAGAGTGACCTGCAGTGTCGTGCAAGTACCGCAAGATAGCATGTTTATCCGCTCATATTGAGCTCGAGCTCGAGC
TGGCCGTTGTGGTCAAAGATATCCACCGGCAGGCAACTCAGGATTGAATCCTGGCTCTGCAGGCAGCAGTGAGGGCCACTCATACCGAGACGCCATCCGT
ATCATTTGCCGCAGGACAGCCGCGCCGATCTGCTCGGGCGAAGAGAAGCGGAGGCGTGACCGGATTGGGCCACGTGCATCGAGAGCGTCCTGCCAGCGAG
TGACGTGCACGGCCGACGTTGTGCCAGCCCGGTGCTGTCAAAGTCGGTTTTTTTGCCGGAGCGACGCTTGTTTATGCCTCAACTGTCCTGCTCTGTCCAG
TAACGTTTCGGCGACCAATGAGAGAGGCGTATCTTGATGACTAGAGGTGCACCTTCACCTTATTTGATCGTACTTAAGAGCGTGGTGGTACCTCTCACGC
TGATTGGACATTCCGCTTAGGTACGGTTGGCCAGTGTTCCACCTCCCCATCCCCCCTTCAACACCAGAATTGGTGACGATCTCATGGCGGTCACCAACGG
AGCCCGAGCGCCGGCGCTGATAGGCCCCCCGCTGGTGCAGAAGACCCGATTGGCGACCCCGTGCCGCCGTCACACCCGGATGGACCTCAAGCAGCCGTCG
CGTGGTTGTCGCCGCGCTCTTGGTCACTGGAGCGTTAGCGGTACAGCCGATCAAGCAAGCCTGCAAGTCGAGGAGGAAGCCGGGCGCGGCGACGCGCAGC
GCAGGGCGGTTGACTGCCTTCGTTGACGAAACACGCTGATTGAAGAAGACCTCCGACACGCAGTTGCCGACACGCGGTTGCCGCGCTCGCGAAAGAAAAT
CTGTCAGAGAGGCGAGGACGGTGCAGTCGAGCGGTCGCG