Description :
From Genome Similarity Track
Location :
Scaffold_190:35528- 39346
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_190-snap-gene-0.30Myosin

Sequence
3818 bases(100 bases per row)
GTCGCCCGTCTTTTGCCGGGCCAGCTTCTGCGCCTTCAGCGACGCAAGCGTCGGACGCTCGAACTGAGACTTGCCAAGCTTGCGGTTCACGTAGTACACC
CGACCCGTCGAGCGCGACACCTTGGCCTCCCACCCGACCGGGAGCGACACCTCCGGAAGCGCGTCCAGGTTGAACGACTCGCGCACAGGACGATCGGCAA
CAACGGCAGCAGCAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCCTGCTGCTTGCTGTTGGCGCGACGACTGCGAGACGCAGCCGCCTTGG
CGTCGTACATGTTCTTGACGACCGACATGCGGCCCTTGATGCTCGACATCGCGCCAGTCACACCCACCTCCACGCTCTTCACCAGCGTCTGCCGCGTCGT
GAACCCGTCGCCAGCCGTCGGCGAGTCCTCGTCGATGGCCTCCGTCACGTCGCTGCCATCGCCAGCCTCGCCCTTGGGAGTCTTGTTGCCCCAGAACTTG
GCCGCCGACATGCTCGGCATGCGCGGGAAGTGCGACCCACGCGTCACCGCGTCCGCCGCCTCCTTGGACCCACGGTTGAGGTCATCCGAACCCGTAAGCG
AGTCCATCAGCACCGTGTCGCCACGCGCGGTCGACGGCTTCTTCTCCTTCTTCGACCCGAGCGTGCGGAAGATCGACTTCTTCTCGCGCGGCTTCTTGTC
CTCGTGGCCGGGAGTCACACCAGCGTTCTCGAGCTGCGTCGTCAGCTTCGCCGTCTCGGCCTCCAGGTGCGCAATGCGCTTGTCCTTATCCTTGACAGTG
TCCTGCAGCTGACGGATCTTGACGTGGTTGCTCGCCGAAGAGTACTCCTTGTCCGTCTTGAACTTCTCCACCTCAGCCTTCAGAGCCTTCAGCGTAGTCT
CCATCTCCTGGTTCTTCTCGCGCAGCTTAGAGTTCTCGTCCTGCAGCGTCTCAATCATACCGCCGGCGTCCGCCATCGCCGTCGACGCGCCGCCAACCGA
GTCGCGCTTGATTCCGCTCAAGTCCGGAGCCTCCATCGACAGCAGGCTGTTGCGCCGCTCGTTCACAAGCTGCGCGTTACGGTCCTTCTCCTCCGCGAGA
CGCTTCTTCAGGATCTCCAGCTGGAACGCCATGTCGCGCTGCATGCGGTCCTCCTCCAGCGCCGCCAGGTACTTCGGACGCTGGATCTTCATGCGCACAA
TAGCCTGCACGCGGATGATCATGTCGCGGATCTTGACGTACCTCACCTTCTCCAGGTGGCCGCGAACCATCTTCTGGATGACCACCGCCTTGTGGTTGCG
CTTCACCTCGTGGGCCACGCGCCGACCCTCAATACCGCGCCACCGCGCCTGCGCCTGGATGAGACCCGTCACAAACGTGTTGTATCGGCGCATGGCGATG
ACACACCGAGCAACAGACTGCAACTTGATGATGGCCTCCAGCTTCCGCAGGTACTTGATGCGCTGCGTGAACCCAACCATGACATTCTGCAGGTACGTCG
CCTTGGCGTCCAGGAACTTCTTGCGGCGGTCCTCGAGCTCTTCGAGCACGCCCAGCTGGAAGTACACACGCGTCTTGCCCATCTGGTATTGCTCAGGCGC
CGACAGCTTCAGCTTGTCCAGCAAGAGCTGGCACTTGTCCGCAGCCGTCTCGCCACCGTGAGGCACAAACAGCCAGAACTTGTCGAGCAGTTCGATGTGC
GCGAGTCGGTTCGGGTACGCAGCACGCGAAATGCGGATAGCCTCGATCACACCGGCACATCGCAGCTGCGAGATCACCATGGCTTGATCCATCACCGTCG
AGCTCTTGATCGGGTTCGGCTTGATGCAGCGCACGTAGTGCACCTTGGTCGACTGGATAGTCGTCATCAGCTCGCTCAGACTCTCCTTGAACTGAGTGCC
CACAGTCGCGACCGTAAGAGCACCGCCGCCGACGCGCGACTTGCGCCGACCTGCACCCCCAGTGCTCGCCTCCTCCTTCGGCGTCTCCTTCGCTGCGAAC
AGCGCCGCCACAAACGGAGTCGCCGAACCGCGCATGAGCTCCGACAGGTCCGGCAGCAGCGCATCCTTGTGCTTCTCAAGGAACCCGACCGAGTCGTACA
GCACCGGCGCGGCGTAGTGCTTGATCGTGAACTCAGTGCGCGACGTGCGCGGGAACTCGATCACGTGGGCCATGTCCTCCTTGTGCAGCGACGCCACCTT
CGACATGAACGACGCCTCGTTACCCTTCGGACGCATCACCTCCTCGTTCAGCAGCGAGATGATACCCATGCGCGACTCGATCACCGTCAGCACATCTTGG
TTGTCAGAGTACTCGATGTGGTTCCACGCGATACCTTCCTCCTCGTACTCGATCTGCACAGTCTTGAACACGTCCTGCGTGAACTTCTGCTGGAGCTTCT
CGTTCGCGTAGTTGATGCAAAACTGCTCGAAAGAGTTGTGCTTGAAGTGCTCAAAGCCGAAAATGTCGAGCACGCCAATGTGGTACGCCATGCGCGCGTC
GTCCGCCAGCGAAGCGTTGATGGTGCTCACGAGCCAGTCGAACACGTTGCCGTAAATGGCCTTAGCGAGCGCATCACGACAGTCGACGGCCTGCTCGCGT
CGCAACGGCACGCTGTACACGTCGTTCACAGCGCGCACCGTACGCCAACACAGCGCCTTCTGCAGCGCCTCGCTAGTCACGTTCAGCATGGCTTGAGCGG
AAGCCGCACCAACGTCGCCCTCCACGATCCGCGACTCCTCGTCATCCGCAGGGTTGGCTTCGATCGCGACTTCACCGAGGTGCAGCACACCAGCAAGCAC
CTCGAAAAGCGGCTTCTGATCTTCCTCTGACAGTCCCACGAGCGTAAGCGCGGCGCGAGTGCGCTCAAAGTGGGTCGCGTCCGACATGCCCTCGATCTTC
TGCACCGAGCTGTCGCCCGTGAACGAGTAGTGCTTGCCGGGGACCAGCTTCAGATCGTCCGCGAGCGCGGGCGTCTCGAGCAGCTGGTAGAAAATGTGGT
AGTTGCGCTCCGGAGCTTCGTGGCTGATCACACGCGTCTTCTCCAGCAGGTACGTGCGGCACTTGGCACCAACAAGCGTCCCGTCCACGTCGAACTGGAG
CTGCGTGAACTTGCCGAAACGCGACGAGTTGTCGTTGCGCACCGTCTTGGCGTTGCCGAACGATTCGAGCAGCGGGTTCACGTCAATGATGCGTTTGATA
GTCGAGTTGTTCATACCGCCAGCAATGGTGGCCAGGTGGTTCATCAAGATCTTGGTTGTCTCCGTCTTGCCGGCGCCAGACTCGCCACTCACGAGGATCG
ACTGATTGCGGTTCGAGCGACGCATGTTGTCGTACGAAGCCACCGACGTGGCGTACACGTGCGGCGGAAGTTCCTCCTTCGGCTGCGTCAGGTACCGCAC
GTGCTGCTCCTCGGCGTAGAGCTCGGGCAACCACTGGTACGGGTTCACGGCGATGCAGATATCTCCCGTGTACGTGTACGGCAGCTGCTTGAGGAAGCGC
TGCTTCATGTTGAACAGGATCGCCGGCTCGTGCAGGTAGTTGAGCGAGATCATGTCCTCCGTGCCTTCCTCCCCGACGTTCTCGTTCTGGTACGGCAGCG
CCTCCAGCTGGTGCGACGCCAGCATCGCCTTGACCTTCTTGTCGGCGAGATCCACGGTCCGCTCCTCATCTTCGCCATCGGGAACCCGCACCTTGACCAC
CACGGCCGTCCCTTGCTCGCGCACCACCTCGGCCTCGAGCCACACGTGCGTCTCGTCCGGCACGTAGACCTTCTGGCCCACGCCCATCGCGAGCTCGCTC
ATGGTCGCTAGATCTCTC