Description :
From Genome Similarity Track
Location :
Scaffold_837:3552- 5792
Transcript NameFunction/comments
Phyke_g11171hypothetical protein

Sequence
2240 bases(100 bases per row)
ATGTAAAAAAGACACTGGTTGTGAACAAACAAGATGTATTGAAGTTAACGACGGCGACTACAACATGCGAGCGGCTGCGACGACTCAGGTCTCCTCGATG
AACTTACCCTCGAGACGCGAAAGAGAGTAGGCCGGGTGAGCACGCGTCACGGTGCAGCGCTGATGGGCGTCCAACGGAGACCGGAAGAACCGACGCCAGG
GTTCACGCGCGTCCAGGTCTTCCAACGCGGCTTGCAGAGACTGGTGCTCGTTGCCAGGATACCAACGACCCCGATCAGTACGCGGtggtggaaaatgaag
aaacAACGGGTCAAGAAGCAAGTCCATGTCGGCCAAACCGTGACGGAATAACGCCAACGCAAGCTGCAACACACTCGCCAAGTAATCACCGGCATGCGAC
CGACGTGAGTTTCGACGACGGCGCCAGGCGTCCCAGGTCGGGCCGCTGGGCAACATCAAGTCGTGGGACGATTCCCAATACGCTTGTGCCCAATGGCTCA
GGTGCGTCTCATAGCGCGCCAAGAGTGTCTGGAACGAGGCATCCCCATCGGTGAACGTGAGCGGTGTCGCCCGCTGTTCCAAGTAGGCCCACGGCTGAGT
CGCGTAAAGCGCCTCCACGTTGGCGCGCGTCACAAGACCGGAATTCCAGGACGCCGGCACTGGAGGCGCCGAAGATGGAAATATCCAGAGCGGGAGCGGC
ATGTATAATCGTCGGGTTACAGGAACTGAGATGGACCCCAGGGTTAGCGACCTAATCGACGCCGGCCATGGTGCATAACTGTCATGTTCCCACTCCGATC
GGTCACGGACCGGAGGAATCACCGGCGAGAAGGATGGTGTTGCCACGGCTTCATCGCCAGAGCTCGACGGGGCAGGTGACAAGCCTGACGCTGGTGAAGA
CGggttcgacgacgacgacaatgacgacgatgacgatgaaatcTGACGCGCGCGACGCGAACGCGCTAGCACGACGCTGTCGGAAGACCTGTCAGAATCA
CTGCTCCGAAGCCTACGCTGTGGGGTAACCGTAGACGCTGACCCGGCGGAGGAATGACGGGCACTGACGGCTGCGACACTGTCCGACGCAGCAGTGTCGG
CCTTGGTTGACGACCGGGAACTACGACGAGGGgttgctggagaagacgcgGCCACCGATCCATGCACGGAACTAGAAGGGCGAGAACGCGTCGGCGAAGA
TCGGGCGGAACGCGAAACTCGGGTAGCGGTACGCGATACGGAAGACGCCCTCGATGTGGGTTGGGCGCGCGACGCGCGTCTTGCCGACGACGGGAAAGTC
GGGGTCGACGTCGtagctggagaagaaggagcaacGCCCGACGCAGGTATGCTGGTGGTCGACGCAGCCGCTGGAGATGCGGACACGCCCAGACCTGGGG
CCGTATACGCCGACGGCGACGCTGATGTTGGAGTAGTAGACGCCGACGTgactggagaagcagacgGGATCGAAGATGGAGTTGTCGACCTTGCCGGTGG
AACAGGGGTCGCGCCAACAGAAGACGTGCCCATCCCTGACGCTTGAGCGGGGTCGTCGGGAGGCAACGGGACCGCGGTGTTGACGGCGATCTCCATGTCT
GCCTCCAAGGAACGAGTTAAACCCGCAATGTCCAGAGTACCACCGACTTGCACCACAGCGGAAACAAGTCGGGCGGCCAAGGCATCACGAGTACGGCGAG
CAACCTCACGGCCCAAGCGGGCATCGCGAAGCAGACGGCGCCATGCGACGGCCCGTTCTTCACGTTCACGCTCCAAACGCGCGAGCTGCTCCCCCAAGTC
GTGAACGAGCACGTTTAGCTGATGGCTGCGTGCGTCGGACTCTCGCTGACGCGCTGCAGAAGCCCGACGTGCGTTCACCAAGTCTGCGCGATAATGGTTG
ACGCGAGACgacgcctccagctcctcagcTTGAGCCCGGCCGAGATCGGACTGCGCAGTTATCCGCGCAGACTCCGCCGCAGACACGGAGGCCTCCAAGG
ACCGGATACGCGTTACGTCTCGTTGATGCTCCTCGGCATGCGCGACCAGCAAAGCATTCACACGTCGGAGATCCGTCTGGAGTGGCAGGTTGAGAGCCTC
GGCCGACGTGGTCCCCTGACGGCTCTGCGAGAGGGCTTGTCGAGCCACGCACAATTCAGCGGTCACCGCGGTACAACGTCGGACGTGGGCTGCGGAGTCA
CGGAGTGCTTGATCGCATTTCACATGAGCCGTCGAGAGCT