Description :
From Genome Similarity Track
Location :
Scaffold_1510:3552- 5199
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_1510-abinit-gene-0.5Transmembrane protein

Sequence
1647 bases(100 bases per row)
AGGAAGAATACCAAGTCCTCAAGTCCCCAGTGCCGGACCTGGAAGGTGGTGCGCTGCGTCCTGGTGGTGCGCCAAACCTTCTGAGCAGGCATCACATTGG
CCTGATCCTGCAATACGGTGTCGCCGGCGTCGTGTACGGCTCGGTGTACGGCGCCGTTTACCCGTTCTTGACCAACTACTTGCGTATGTCGGGTGCGGAA
ACCACATCGGCGTACGTGCTGGTCACGCTGCCCGCGACGTTCAAGATGTTTATCGGCATCTTCACGGACTGCTTCCCTANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGATCCTCTCCTTTGCCATGCTCGTGACCATGGCGTGCATTCCAATCGGAGACCCGTACTACCCGGACC
GAAAGCTCGCGAACATCGCCCTCTCCAAGCTCACCCCAGAACAGATTGCGTCGTTCAACACGGACGCGCCACAATCTGGTGTCAAGTACATCTTCATGAT
GATCTTCGCGTACCTGGGCTGTGTCATCGCGGTCACTGCCTCTGACGGTATCCTCGTAGAGCTCGCGCAGCGAGAGCCTGAAAAAGTTCGAGGTACTGCG
CAGACGATGATCGCGATGGCGCAAGATGGATTCATGGTGCTCTCCTCCAGTATGGTGGGTTTTGGCATGAATGGCCCCGAGTACGGTGGTTCGTTCTCCG
GGTCCATGGGCTTCAATGCATTAATGGCGATCTGCGCAGGGTTCGCATTCATTAACATCTTTGCGGCGTGGTTCTGCATCTCGGAGGAGAAGGTGACGCA
GCGCCAATCGGCGCGCAAATACTTCTGGATTCTCTACGACCTGCTCTCACAGCGCGTCGTGTACCAGATTATTGTCTTCCGTTTCTGCCGCAACCTGTTC
TTGAACTTCGGTGTGACTGCCTCCGATCCGATCAAGAGTGTCTGGGCCAAGGTCGAGCCCCTGAACAGCTCCATCTCGTCAATTCTCGGTCGCGTCTGCT
CTGTGATCTCCCTGTACATTCNNNNNNNNNNNNNNTTAAGAAGTACGGCCTGCAGTGGAGCTGGCGCCGCACGCTCGTTGTGACGCAGATCGCCGTCATC
GTGATCGACGCGTTCCCGACGTTTTTCACGATCTGGAACGTGTACCGTAGCCAGTGGTTCTGGTTGGGCGNNNNNNNNNNNCGTGCCGATCGCGGTCAAC
GTGCCGTCAGGCATCAGCTTCATCGTGTCCACTTACGTGATCGTGGAGCTCGCGAACGACGGCAATGAAGNNNNNNNNNNGCTACGCCGTGATGGAGATC
ATCGACATGGGCAACGAAGCGTCCGTGTACGGGCTCATTACGACCGTCGCGACACTGGCTTCGCCNNNNNNNNNNGTCCGTGCTCACGAAGAACGTCGAC
GCACATTTTGACATTGCGCGCGCCAACCTCGTCGAGGATGACACGCACGCGCGCACGCAAGTGACGTACGCGTATCTCATCTCGTACGGTTTCAAACTGT
TCTCGTGCGTTTTTGTGTTCCTGCTGCCGCGCCAGAAGGCCGAGACGCAGGAGCTCGTGCGCACGGGTGGCTCGAGCAAGTTGCTCGGCGCACTCACGGT
CTTTTACTTGCTCTTCGCGTTCGTCTGGTCCGTCATGACCAACTTGA