Description :
From Genome Similarity Track
Location :
contig_37:355150- 363478
Transcript NameFunction/comments
g7626.t1transketolase
g7627.t1hypothetical protein
g7628.t1conserved hypothetical protein
g7629.t1hypothetical protein

Sequence
8328 bases(100 bases per row)
GGCCTGCCCAACCTGGCCAACTCGACCGCCGAGGTTGTGGCCAAGGGCGCCTACATCGTCGCCAACGTTGCCAACGGCGCCGAGGTGGAGTCGCTGGAGG
GTGAGCCGGATCTCGTCCTGGTTGCTTCCGGCTCGGAGGTGTCGCTCTCGATCGACGCCGCCAAGCTGCTGACCAACTACAAGGTGCGCATCGTGTCGGT
GCCGTGCCGCGACCTGTTCGACGAGCAGTCGATTGAGTACAAGAAGGAAGTTCTGGGTGAGGGCATCCCCGCCATGAGCGTGGAGGCCGCTGCCACCTTC
GGCTGGGGTACCTACTCGCACACGCAGTTTGGCCTGGACCGCTTCGGCGCTTCGGCCACCATTGCCCAGCTGAAGGAGCACTTCGGCTTCAACCCGAACA
CCGTCGCTGACGAGGCCCGCAAGCTGGTCAAGTTCTACGACGGTCGCTCGGCTCCGAGCCTTTTCGACCGCCCGGCTCTTCGTGTGCTCAAGGCCACGGA
CCACTAAGCACCCTTAGCGTGCTGTTGGCAGTGTGAGGAAGTGGACGAAGTGAAGCAACCCGTATTGACATGTGAATCCTAGCTTGTCATCGTCTTCAAC
ATCTGCCTCGTCTCCGTGCCCTTTTTAATCCAATCATATTACACTTCCATCTTATTGGCCTAAACGCAGCCAGCATTTCAACCTATCAAAATCAAGGGAA
ATATCCATTAGAATTCAAATTTGAACGTCGACGAGAGCAACTTGTAGCTGCTCCGCTGCATGGGCCTTCCTCGGCTCTAGAAACGAATCCAGCGGCATGG
CGACACTACAGACAAAGAACATGGACCCGCAGCTCGCCTCCAGCTCCTCGTCTGATGTTTCGAGCTCTCTGACGTCCTCCAGGGGACACAAGATCCGTCC
AAAATCGAGTAAAATTCTCAAAAAACTTCGGCACGCAGGGAACTCAAGCGCTCCATCGAGAAGAAGTTCCGGCTGCGCTACGCGTCGCTGCAACTGGCCT
ACGAGCAGCGCCTGGAAGTTCTGGCCAATCGCGTGCAGGAGGCCGTGAGCCAGGTGCACGGAGACGCCACCATCCACTGCCTGCAGGAGAACGCGCTGAC
CAATGAGTACGCGAGCGCACGGCTGGGCGAGATCGTCCACGAGTGCTTCTACGGGGAGAGAGAGCGGTACGTCAAGGCCATGAGCGACCAGATCGCGTGG
CAGGCTAGCGATCTTCGGGAGGCGCAGCAGAAGCTAAGAGTCGTGCAGAAGCGAGAGAGCGACGCGCAGCGGCATTGGAAACTGGCGCAACAGGATATCC
AGGCGCTGCACCATCAGCTGGATGTGAGGGTGAAGGAATTACAGGAACAGAAGAGGAAGGAAGGGGATTTCAAGATGCGCGGCCGTGCGGTGATTGAAGA
ACGAGATGCGGCGAGGAGGGAGGTGGACGTGCTGAAGCAGAGTGTCCAGACACTGGAGACGCTGCAACAGGAGCATGAAATGTTGAAGAATAGGATGCAA
CGTGAAGGTGAAGAGACACGAGAGGCTCGTGGCGAGCTGGAACGGAGTGTCAAGAGCTTGCAAGAGGCCAAAAATGTACGTGCTCGTTGGGAGGCTCATG
AAGCGGTGGGGCTCGTGTTGATTGTTGATTTGTGTTGATTGCAGAAATTGGAGCTAGAGAAGCAGGCGAGTGAACAGGAGGTGCTCCATTTGAAGCACTT
GCTGACAATCTCGGAGAGTAATACCCGGGAAGTAGGGCAGACGCTACAGCTACTGCAGAGTGAAGATTACCCAAGTAAATTGGCGCGCTTCGAGTCCGAG
CTGACTCATCAACAACAAATGGCTGTGCTCGCCGAAAAAGACCATGAGGATCTTAAAAAGAGATATGAAGAGTTCGGCGAGCAGGTGGATCAGTACATGA
ATGAACAGGCACAAGAGAAAGCGGCGCTAGTGTTGAAGGGCGACGAGCAGGTAAAACAACTCCAGGTCCAGCTGGATACCGTTGGCCGACAAGCTCAAGA
TGCACTCAAAACCAAGCAAAGTGAGATTGCACGGCAATGGATCAAGTTAAATTTCGACAAGAGGCACTGATCAAGGCGGATAAAAAGATTGCATCCCTTG
AAGAGCGTGCGACTGCGGTGGAGGCCCAGCAAGTAGATATCAAGTTACAGCACGAGAAGAAAGTTGGAGGCTTGGAGAAGGAAGTTGTCCAGTGGCGGCA
CGCACTGGAAAAAGAACAGGAAAAAGTTATGACTCTCCAAAATGTGCTGGCAGAAGCGAGAGATAAATACGAACGGAAGATCTCTCGCTTCAAGACGCAA
TGAACCGGCAAAACCGACAAGGGGCCCAAGAAAAGGAGTTAGAGGCTCGTACACGTTGGCAGAATGAGTTCGTTGCTAAACAGGATTCAAGGATCGAGGA
GCTGAAGGAGAAGTACGATACTGCATTGCAGAACCAGCAGACAGAACTGCTTCAGGCTCGGCAAATGGCTTGGAAACCGCTAATACCGCAGCAGTGAAGT
GGGAAAAGGCGAAGCTTGCTCAAAAGGAGGACGAGGAGCTTGAAAGTCGACGCCGATCCGAAGATGCGGCTCGAGAAAAAGAACGGAAAGAAGAGCAACG
AGTGCTACAACTCTCCCAAAGGCGCATGCAGCACGAATTTGACGAGCGAGAGAGACGTCTTCTGGAACGAGAAAAAGCGCTGGCAGAAAAAGAAAAACGG
GATGATCGCCGGAGGCAAGAAGAGGCGAAGAAGGCGGCAATCCCACCTCCGGCACCTACTACGCCAAGTGTTGTCGTTTTGAATATGGGCTCTGCGAGGA
TGGCGAGGTTGGAGATCAACGAGCGACGAGTAATGCGGTGGTTAGAGTAGCTCCTACAACCCGTCGCCACAGTAGAAAATTTTCGGAAAGGGAACGCCAT
GAGCAGGAGGAAACCAACGACAGTATTCCCCTTGCGCAGCATACGGCTGAGATACAAGCAAAAGAAGCTCAAGCTGCCTTGCGTGCAGAAGAAAGAGTGC
AAAAGCTTATGCAAGAGTTTCAGGAGCGAAAAGAATCCGAGTTTCGGGCTGCAATGGTGAATGTGAGGAAGGGCATTCAAAAACTGGAGGTATCACTGGA
GGAGGCGAGAGCGGAAAAGAAGCGGATTGAGGAGCAGCTATTGAGTGAGCGTCAGGCATTTGTCACTCTGAAGAATGAGCACGATGAATCCAAGGATACA
AAGCGTACGCTTGTGCAGAGGCTGGAGGAGGCGAACGAAAATCTCGGCAGACTTCGGAATGTTGTGGGCGATTTGCAATCTAAGTGTCAATCACTGGGGG
AGCAGTGCAAAACCGCCGTTGCGCAGAAAGAGGAAAGTGAAGCTGCAGCTGATAATGCTCACAAGGTTAGCGAAAATCTTCGCGAACAGCTTGGACGCCT
AACTGAGGCAGCCGCTCGTCTTGAAAACTCTCTTGACACATCCGTGGAATCAAGTGAGCAATCGAAAAAGGAGCTGCTCGACCGAATTGCAGTGCTGGAA
CACCACATTCAAGTTCGAGAAGAAAACTTTGAGGCGGAAATGTCTGCCGTAGAGGAGGCAAATACACGCGAGCTGCGTAACGTGTCCTCACAGTATGACA
CGCATTTGCGCAAACTCCAACAAACAATCGACGAGTCACAGCAGGGGCGCTTGGAACAGGAAACGAATGCCAGTCAGTTAGAGTTGTCTGTGCACGAATT
GACCGCTGCGAAGAATTCCTTGCAAGCTATGGTGGACCAGCAGAAAGTTGAGATAACTCAGCACAGGAAACAATTTGCCGACTTGTCACGTATGCACAAG
AACCTCGCTGAATCCATGAATGGTCGAGTGAACGCTGCAAACGAAGCTGTGGAAGAGGAACGAGGAAAACGCATCACGGCTGAAACGAGAGCGCTAAAGG
CAGAAAAACTTGTTGAGCGAGTCAAAAATGAGCGTGAAAAATGCGTGAGTGCTTATCGTCAGAGCCTGCAGCAACTGGTACACGACTGGAAAGAAGTACG
CAAGGGTGTTACGAGTGAAATGAATGTTGGCTGGGTACACTTGCAAAAGGAACTCGCGTTGGCTGGTGTGGAGTGGAAGAAACGAACGGATGATCTCCTT
CAGGGAGCCGACTCAGTGTGGAGACGGAAAGCCAAAGAAGATAAACAAGAGTGGAAGACGCGCATTGCTCAAAAAGACAAGGAAATGGATGGATTGTTGT
CCAGCCAACGCGTGAATGATCAGTCCAAGTATGACCAGATTGTGGAGCGTTTGGAAAAAAAAGTTCGTGAATTAGAAGAGCTAGAGACGCGGCTTACTGC
CCAACTGGACCTAAACTCCGATTTACAGCAAACTATTCAGAAGCTTGAAGAGGAGCAGATGCTTCGGCTGGTAGAGCAGTCGCACCTTGAGGAACGCTTA
TCCGCTGCTCAGGCTGGTATTCACAAAGAGACCCAGGAAAAGGAGCGCGTGAGTGCCTTATTGAAGACACGGAAAGCAATGTGCGAAGAATACCGTGGAT
TCGTCGCATCGCTTGCTAAAATGAGTGGATCTGACTCTGCTATTACTGAAAAGAGTCATGAGAGGGCTGGGGACGAACAAGCGGCTTGGGAGCGTCGGCA
GTTCTCTGATGAATTGGGTAAGCTAACAGCACGCCTCCAAGAATCCCAAGCTCAAGCGATTCACAACGCTATTGCTGAAGCGACCGTCAGCACAAAGGAA
GGCGTCAGTGCACCTTTGGTGTCCGAATTGGAGTCCGCAAAGAAGGCGTTGAAGTTTTTGTGGAGTGAGCCAGTACTTAGTGATAGTGAGTACGACGGAC
ATCTTCCATGGTATCTTCGTTCTGTCCGAACTATCAGGAGAGAGCGGGAGGCGAACGAGGAAACGGTGTCAGCGCTTCGACAGGAGCTTGCATCAAAAGA
AGTGCAGAAAAAAGAGGTGCTGGAGAAAAAGATGAAATGGCAAGAGGCCAACAATTTGCTGCGTTTTGAGAAGGACACCTTACTGCGAGAGATGGATCTG
CTCCGCCAAACGTTGCAAAAAAAGAAAGAGCAAGAGCTTCAAGAGCTTCGTGCGGAGTATGATGTGCGCATCGAGCAGTTGAAGCAGCGACACGACCGAT
CAATTATGAAATCGGATCAGGATTATGAGGTACGGTCATTGTTACTATGAAGGCCTAACTTTTCTCCCCTCTCGCTAATCTCGCTAATCTCGGTGTATTG
GGTTTTGGCAGACTGCGACGAATCAATTGAGGGATGTACTCGAAGCAGAGCGGCGAGCCACCAACCATGCCAAGAACGAGCTTGTTGAGCTGGTAAGATA
GTGCGCACGATGTTTTATTCTGCATCATTGATGGATGACACCACGTTCTTCCTACTTTTTGCAGAGAATGGCGTTAGAGCGAACAGAAGAAGAACTCAAG
GAAGTACATCAAAAACTTGACAAGGAGACGGATGAACTTCGCGAAGCGGTGAGAATTTGTACTTTTGCGCAGTTTTATTCAACGCCCTGCTGACTGCGAA
TTACCTCTTCAACATACAGGCAGGCAAGTGGAAGCGGAAAGCCAAACTGGCCATGAAGAACGCTGGCGGTGGGGGTTCGACGAAGGGAGCGCTGCGCATG
TCGTCATCATCGCACGGAACGGAGGAGGACTCGGACGCGTCGTACCGCATGATGTATCCGCAATCCCGACGAGCGTCCAACGCCATGACAGACTTGTCGA
ATCTGATGGAGCAATCGCTTGTCAGCATCCGAAAAGAGGCTCTGGTGCCGCTGTCTCCACATCTTCAAAGATAGACAACATTCTGTAGTAAAGGCTATTT
AGTCATTGTAAACAGCGCACACGTGCGTGTTTGCACAAATGCATTGATTTCATTTATTGCTGAAGCAGCTCCTGCTTCCACATAGCGAGCATCTTGCGCA
GCTCCGGCTCCCAGGCACTCACCACCTTCTTTGCGGCGAGTTCGCGCTGGCTGCTACCGTTGGTTGAGACGAGCACCTCATAGTCGTCGCCGCTCGTGTC
GTCAAAGTCCTGCAGCTCCACATGGCCCGATACATCGTCACTGCCCTCCCACGCGAACTTGACCGACAGTTCGTAGCCGCAGCGCTTTTTGCCGCGACTA
AAAGACGATCTTCTCAAAGCACGAAATCTCAGCCACAAACCCCTCTTCAAAACACTTTTACCCACTCACCTTCGCTTCACCGTCACAACGCACAATGGAC
GTGGCCTTGATGGACAGTCCCTGCGCCTCGTCTTCGAAGCTGAAGGCCGTGAGGATGTGGTGTTTCAGTCGCTCACGAGCCCACTCGGACTTGTCGCGCT
CCTCCCTGCAGACACCAGTTAGAAAAACTCCTTCCCCGCCGACACCAACCAGTAACTCCGCAGCGCACCAAGTGCCTGCCGCATTCCACACGGAGCTGGA
GTCGCTCCGATGCACGGGAGCCGTCACCGCCGCCGAATGGTCGATCCGCACAGGGGTGAAGTCCTGAATCCGCGGAATTCCAGCACCAAAAACAGCATTT
TAGTCCCCATTTCAGCAAATTAATGCTACTACACCCGCACCTGCGACGTCTTGGGGATCGTCTTCATCCAGCCGTGGTACCCGCTGTGCATCTTGGGGGC
GTCTTCCTCACCGCTCGACATCGTATCTGCTGGAATATTCGATAATGACGCCGCATTCACGTCTTTTCATCCAATCACCTACCTCCACTCTCCTCATTCG
TAAAAATCAAATCATCATCTACCCATACATTAAAAAAGGTAGAGCGCCCTACCATGCCGGGTGTCTGGAGCGCGCACGTGACCAAGGAGGGCCGCACATA
CTTCTACAACCGCACCACGAAGCAAAGCGCGTGGGAGAAGCCCGAGGACTTTGACGGAGACGAACCCCCTGCCCCCTTTGGCGCCAAGAGGCTCGAGTGG
GAGGAGCTCTGGGACCCCAAGAACGAACGCGCCTATTACTACAACCGGGCGACGCGCAAGACCCAATGGCAGAAACCCGAGGGCGTGGAGATCAAGCCCC
GCGCGGGAGCGAGCGACAAGAAACACGACAAGCACCGAACCAAGGCCAGGAAGGGCGACGAGAACGGTTCTACCCCGCGGGAGAACGAGCCTACCGAGGC
TGAGGAGAGCAAGGCTAAAAGTAGTCGGGAGGAGAATCAGACGCAGAATCAGGCTGAAGATCCGAATCAGACTCGGAACGACGATGTTAATGCACAAGAA
GCAGCGCCGACGTCGACGCATAGCAAGAAGAAGAAGAAAAAGTCCAAGAGGGACAAGGCGGACACTGCGGTGGTGGACACTCAGAGGAAACGGCGTCGAC
AGGATGAAAAGCGACTCATTATTTGGGATGATGAGGAGCAGGGAGTGGATGTTACTCGGGCATTGAGGAGAAGGATACGGAGGACGGCAAGGAAGCCACT
AGATTGCTACAGGAGCTGTCCACGACGGACGCTATTATGGAAGCCAACGTGCTCTCGGTGATTAACGGGTTCTTGAGAGCTCATACCGAGTCCAATGGCC
CGGAGATTCTCGTGGAAAAGCTGTCGTCCTCGTACCGTGGCCATGCTCAGATGATCGGCCTCGTGGCGTCGTGGCTGGACACGCTGCCGGTTTCCACGAC
GGCGTTGGAGAACAAGATGACGTTTGATGTGAACGAGGGAGCGGTGATCTCGAACAAGGGCGCGTCGTGGGACCCGGCCGAGGAGATTCTGTACAGTCAT
CTGAAGGACGTTATTAATGAGAACTACGACCCGAAACTCGTGTCGAATGTGCTGAGCGGGTCGGCGGTGGAACCCGAGTGGCTGACACAGATGCTGAACG
ATCGCAAGTGGCGACTTATGCTGATTGAGTTGGCCGAAACACACAAGGTTTGTAGTGATCTTGTTGTGGAGTTGATGATGGCAGATGCTGACGGTGTCGC
TTTCGTTTTTTAGACATGCACGTTGCTGCAGTACGCGATCCGACGAATCTCAGAGGCTGGACACCACAAGGAAATTGCCTCTATCACGAGCGCGAATGCT
TTCTTCCCTGTGTTCGGCGGTGTGTTGGTAGACGCCTTCAGCCGAGTAAGTATGGTCTTGCTCCTACGGCTTTAACCTTACGTAATCTAACTGACAATTG
TCTCCCACAGATTCCATTTGCCAACGAAGAAGAAGTGGTGGAGGACATCACCGCACTCAACAAGATTTGCTGTCAGTCTTCGCACTCGTACGTCTATGCA
CAGGAGCTCCTTTGTTCAATGGACGACAAGCTGTATTTGATGCAGAAGGATGCTGGCGCTGAAAGCGCAAAGTACTCTCACATCCGCATGGTACGCTCCA
AGCTGAACCGTGTGGGCGGCGAGCTCCA