Description :
From Genome Similarity Track
Location :
Scaffold_299:355112- 356952
Transcript NameFunction/comments
Aphin_H310_02610heat shock 70 kDa protein

Sequence
1840 bases(100 bases per row)
CCGCCAGGTGCACCGCCCGCCGCATACAGCTTTTGCATGATCGGGTTCGCAACACCTTCGAGTTCCTTTTGCTTGGCCTCAAACTCTTCCTTCTCAGCCG
ACTGGTTCGCATCCAACCAGCTAATGGTCTCAGTCACCTTGTCGTCGACTGTCTTCTTGTCCGCGGCATCCAACTTGCCTTGGAGCTTTTCGTCGTTCAG
CGTGTTGCGCAAGTTGTACGCATAGTTTTCCAAGCCGTTCTTGGCTTCGATGCGAACCTTGTTGGCTTCGTCTTCCGACTTGTACTTTTCGGCTTCCTGC
ACCATGCGCTCAATGTCGTCCTTGGTCAAGCGGCCCTTGTCGTTCGTAATCGTAATCTTGTTCTCCTTGCCGGTCGACTTTTCAATCGCAGACACGTTCA
AGATACCGTTGGCGTCAATGTCGAAAGTCACGTCGACTTGAGGCACACCGCGAGGCATGGGAGGGATCCCGTCCAACGAAAACTTGCCCAACAAGTTGTT
GTCGCGCGTCATCGAGCGTTCACCTTCAAACACTTGGATCAACACACCAGGCTGGTTGTCGGCGTAGGTCGAAAACGTCTGCGACTTCTTCGTCGGCACC
GTCGTGTTGCGCTGGATCAAAGTCGTCATGACGCCGCCGGCCGTTTCCAAACCGAGAGACAAAGGCGTCACGTCCAACAACAGCAAGTCCTGCAACTTCT
CCGAGCTGTCGTTGCCCGACAAAATCGCGGCTTGCACGGTAGCACCGAACGCGACAGCTTCATCAGGGTTGATCGACTTGCACGGTTCCTTGCCGTTGAA
GAAGTCCGACAACAGTTGTTGCACCTTGGGGATACGGGTCGAACCACCGACAAGCACCACTTCGTGCACTTGGCTCTTCGACAACTTCGAGTCGCGCAAC
ACCTTCTCCACAGGTTCCATTGTCTTGCGGAAGTAGTCGCCGCACATGTCTTCGAAACGAGCACGCGTGATCGTGCTGTTGAAGTCAATGCCGTCGAACA
GCGAGTCAATTTCGATGTACGCTTGTGCCGACGACGACAGGGTACGCTTGGCGCGCTCGCAGGCAGTACGCAGACGGCGAAGGGCACGTTGGTTTTGGGT
CATGTCCTTGCGGTGCTTGCGCTTGAACTCCGCCGTAAAGTGGTCTACCAAGCGGTTGTCGAAGTCTTCACCACCCAAGTGCGTGTCACCGGCAGTCGCC
TTCACTTCAAAGATACCCTCTTCGATCGTCAACAGCGACACATCAAAGGTACCACCGCCCAAATCGAAAATGAGCACATTGCGTTCGCCACCCTTCTTGT
CCAAACCGTACGCAATGGCAGCGGCAGTGGGTTCGTTGATGATACGAAGCACATTCAACCCAGCAATGGCACCGGCGTCCTTGGTCGCTTGACGTTGCGA
ATCGTTGAAATAGGCAGGGACGGTGATGACAGCGTTGTTGACGGTCGACCCAATGTAGGCTTCCGACACTTCCTTCATCTTGATCAACACCATCGACGAA
ATTTCTTCAGGTTGGAACGTCTTGGTTTCGCCCTTGAATTCCACCGTGATTTGGGGCTTGTCGCCCGCACCGGGGGTGACCTTGAACGGCCAGTGCTTGA
TGTCGGCTTGGATCACAGGGTCGTTGAACTTGCGGCCGATCAAACGCTTGGCGTCGAACACCGTGTTGGTCGGGTTCATCGCGACTTGGTTCTTGGCGGC
ATCACCGATCAGGCGTTCGCTGTCCGTGAACGCGACGTACGACGGGGTCGTGCGGTTCCCCTGGTCGTTCGCAATGATTTCCACGCGGTCGTTTTGCCAC
ACACCGACGCACGAGTAGGTCGTGCCGAGATCGATACCGA