Description :
From Genome Similarity Track
Location :
scaffold_83:35508- 38498
Transcript NameFunction/comments
g940.t1 integrase putative
g941.t1 integrase putative

Sequence
2990 bases(100 bases per row)
CTGCCGTGCCGTTGGTCTGGTGCGCGTACGGAACCGTGGTTTGCTGCTCGATGCCTTCGACTTCGTAGAAGGCCTTGAGCGAGTTGGTCGCGAACTCACG
AGCTCCGTCGTGCCGCACAAACTTGACCTTCTTGCCGAACTGCGTCTGCACCTTCGTGACGTACGTCTTGATGCAGTCTTCGCTCTCCGACTTGGCACGC
AGGCAGAACCCCTTCATGCATCCGCTGGCTTCGTCCACGATCAGCAGCAGATACTTGCTGCCACCCAGTGACTCTTCTTCCATGGGGCCGCAGATGTCGA
AGTGGAGCAGCTCGAACGTGTCGTAGCGACGCTTGTCACGGTTGCTTGGGAACGGCTTCTGGACCATTTTGCCTTGCTGGCAGCCGCGACACACGCTTGG
TCCACTCGACTTGGAAGGTGCCTTCGCGTCCTTGATCATGTCGTTGTCGATCATCTTGCGAAGCACCTCCACCGGAGCGTGACCCATACGCGCGTGCAGG
TCGACCGTCTTCCCACTGGTCGCCGCATTCGCCGATCGCTGAGGCGTCTGGAGCCAGTAGAGGCCATCCACGAGGTTCGCCGCCGCCACCACTTGCTTGG
AGGCCTTGTGCGCAACGCGCATCTGGGCGCCGTCGAACACGACTTGGAACAGACCACTCTTGTTGATCTGTGGCACGGAGAGCAGATTCTTGCTCATGCT
CGGCACGTACAGCGCGTTCTTGATCTCGATGTCGCGCTCGTCGCCGTTGGGCAGAACCACTCGTTCCACGATGGTCCCCACACCCATGATGGCCGCCTTG
TTGCCGTCGGCCACCGAAAGTTCGCCCTCGTTTCGCTCAATCAAATGGGCGAACTTGGCCTTGTCGTTGCAGATGTGGTGCGTTGCGCCGCTGTCGACCG
CCCACATGCCGAGCATATCCTTGCCCGTCGAAATGCCACACTCCAGTGAGACCGCGAACGCCACTCGATCATAGCCGTAGCCGTAGTCGTAGCTGGCGTC
GTCGTTCCTCCACTGGGCATTGTTGGCCCCGCGTCCACGGCCATTGCCATTGCCGCCGCGTCTTGGGCCCCGATTCTCGTCCTTCTGCTTGGTCCAGCAC
TTGTCGATGGTGTGCCCCAATTTCCCGCAGTACGTGCACTGGCGAGACTCTCGGTCGGTGTTGAACGCCTTGGCCGCGTCCTCCGTCTTCACCGTCGCCG
TCTTCTCGCCTTGCCGCTTGATGTGCTCATTCGTCAGCACCTTCACGACGTCTTGCGATCGCAGCTCAGCGCTGCTCATCTCCAAGTTCAGCACGACGTT
CTCGTAGCTCTTGGGGAGACTGCGCAACAGGCAGATCGCCACGTCCTCGTCCTCCATCTTGGCGCCGATGCTGCTGAGCTTGGCGCTGATGTTGAGGACC
TCGTTGCAGTGATGCAACACGTTCCCGCCTTCCGACATCTCCATGCTGAAGAGTTGGCGCTTCAGGTAGATGCGACCAGCCTTCTGCGAACCACCGTACA
GCGTCTTCAGGCGCGTCCACGCAACCCACGCTTCCTCGCAGTCGTCGACCACATGGTGGTAGTCCGCGTCCATGTGGAGCAACATCAGTCCGAACGCGAT
GTTGCTCGACTTGACGTACTCGTCCTTGGGCCGCGAGTCCGTGAAGCTCGGCGTCGTCTCTCGGTTCACGACATGCCACACCGACTTGGTCAGGAACACG
CCACGCATGTAGCGGTTCCACGTCGCGTAGTTGTCTCCGTTGAACTTGTCGATGGAGACCTTGGTGGAGGCGTCGTGGGCAGAGGACATGGTGCTTGGGC
TCATAACCTGATGGAAGGTATGGATCTTGACACCGAAGCTTGACGGAGCGGAGGGAGGGCAGCACTCTGGGCGAGACCGGAGCGGAGACTGGAAACCACT
TGAGGGGTAGAACGAAGATTCGAAAGTGATTGATTGAGGTCTTTAGCTCGCTAGCCTTCTCGCTACTCTAGACCTACTGGATACACACTACTTGATTCTT
TACTGGATACTGAGTTACTTCAGCCAATGAGAGAGCGCCACGTCGAAGCCCATCTTGTACCTACAATCTTGTACCCACAGGTGGCGTAATCGACAGTGGC
GTAATCGTCGGTGGCGTAATCGGCGTGGGTTCGGATTGGACCGGTTCGGGTTAACCGGTTCACGGTCAACAACCGATACCAAACCGGTAACCCTCCATAC
CCTCCATAGTCGCCCGGCTTGAAGCAGATGCCATGCGTCTTGGTGCCTTGCAGGTAGCGAAAGATGCGCTTGACCGCAACCCAGTGTTCTTCTTGGGGGT
TCTCCATGAAGCGCGACACATAGCCAACGGCGTACGCGATGTCCGGGCGCGTGGCGGTCATCAGGTGCATCAGCGCACCAACAGCTTCGCGAAACGGAGC
GTTCACCTTGGTCGCCGCGTCGCTTGGAACCAGTCGAGTGCTCATGTCCACCGGACTCACCACAGCCTTGCACTCGTCCATGGCGAAGCGTTTCAGGATG
TCGTCCACGTAGCGACGCTGGCACATGGTCACGCTGCCGTCCGGGCCGTCCACCAGCTCGATCCCAAGAACAAACGCGCACTTGCCGCTGTCGGTCATCT
CGAAGCGCGTCTTCAGGTCCGTCTTCGTGCGCGAGATCAGCTCGGGCGAACTCCCGGTAATCAGCACGTCGTCCACGTACACCAGCACGAGCACGCAGTG
ACCGTTCACCACCTTGATGTAGAGGCACGGATCGAAGGCCGACACTTGGAAGCCGATAGAGCACATGAACTCGTCGAAGGTCTCGTTCCACACGCGCGAA
GCTTGCTTGAGACCGTAGATGGCCTTCACCAGTTCCAGGCAGTCAAAGCCACCATCCAGTTCGACGCCTTCGGGAACCACGCAGAACACCACCTCCTTCA
TGACCCCGTACAGGAACGCTGTCACGACGTCGAGTTGGTCGAGAGGCCAGCCGAAGTACTTGGCGATCGCGATGATCATGCGCAGCGTCA