Description :
From Genome Similarity Track
Location :
Scaffold_39:355049- 356713
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G011954Similar to ARL2: ADP-ribosylation factor-like protein 2 (Bos taurus)
Pytul_DAOMBR144PYU1_G011953Similar to ypgQ: Uncharacterized protein ypgQ (Bacillus subtilis)

Sequence
1664 bases(100 bases per row)
TAGTGCGTACAAATCATTCTGACGCGATGTAATATTGGTATTGCGCACGTGTGTAGCTTCAAACTCAACGTGTGGGATGTCGGCGGCCAGCAAACGATTC
GCTCGTACTGGCGCAACTACTTTGAACAGGTACACTTTGTGTATACGACATGCTCACTGCTCTTTACTTGCTCATTTATATCATGCCTAATGTGTCTTGC
ATATCTATATAGACTGATGGCCTCGTGTGGGTCGTCGACAGCGCCGATCGACGGCGTCTGGACGACTGCAAGCGCGAACTCAAGCAGCTACTTACACAAG
AGGTATCAATTATTTGTCTACCTATCTCTTTCCCATAGTATACTGAATCTCATGAATGCAATCTCTCATGCTACCTCATGGTTTGTAGAAACTCGCGGGC
GCGACGCTGCTCATCTTTGCGAACAAGCAGGATCTCCCAGGCGCGCTCACAGCCTCGGAGATCGCCGATTACCTCGAGCTGCGCAGTGAGCAGTTTGTGA
ACCGCCACTGGAACATCGTCGCGTGCAGTGCGGTCACAGGCGCGGGCCTTCTTGAGGGCATCGACTGGCTTGTCGCCGATATCGCGAGCCGCATTTTCTT
AATGGAGTAATGCCGTAATAGCAATCTCAAACTCTAACCCGAGACTCTGTCTTGATCGTGTTCGAACTCGTCTCACGGTGCATGACGCCAACACATTTCA
CCGCTGACAAAATGCCTGCATTAACGAGCATAGCGGCATTTCGGTCTGCGATTTGCAACAAACAAGGCGAACTTTGGATAACAGCCTTGTAGAGCTCCAA
TTTGCTTCGATTGATTCATTCGTGAGGTTGCGGAGGCAGCTGCTGGTATCAAGATGTAGTGTCGCAGTTGGATAGTAGTAAGTGGTGATACTGACCCTCG
CAGTTGCAGCTCATAAAGTGGGGTGGCCACCCTGTTTTTAAAAGATTGGTTGACCTCCATGTGTGCATGCTTTAGTGTTTAGTGGATCCCAAAATGCGTG
GCCAGACGTGTGAGATTTAAACTGATGGTCTCACTAGGAGAGGCGCCAAGTGCTGAGCACCGCGAAGACCCAACGGACCGCAGATGAAGCGGCTGGCTCC
TTTTCGGCACCTCCTTATCTCCCAAGCTCACTTTGCGATTCGCATCGATATCAACAGAGTTATTATCTATCACACTCAGCACGGTGAGCACCGCAGTGAA
CTCTCCGCTCGTCCAGCAAACTGCCGACTTTGTGCGCGAGCAGCTCAAGTCGAACGACGCCTCGCACGACTGGCGCCACATCGAGCGCGTATGGACGCTC
GCGCGCACGCTCGCCAAGGAAGAGGTGCGTTATGTGTATACTCATGGTGTCCTGAGTATGCATACAAGATGCTGACTATATCATAATAATGACAACAGAA
CGTGCCGGAGGAGAACCTCGAGATCGTCGACTTGGCTGCGCTGTTGCACGACATTGACGACTGGAAGTACCAGACCGAGGACGTGAAGACGAAGCGCGCG
GTGCAGTTCTTGGAATCGCAGCAAGTGCCAAGCGAGAAGGTCGCGCGCGTGATGGCCATCATCGACAACATGGGGTTCAAGGAAGAGCTCGGCGGAAATA
AGGTATGTACGTGTTCTGGCGCATCGACACAGCGCCTGCATAAAGCGTCGAGCTTTTATGTTTT