Description :
From Genome Similarity Track
Location :
Scaffold_1176:355- 2748
Transcript NameFunction/comments
Phyke_g11598replication factor C subunit 4
Phyke_g11599vesicle coat complex COPII subunit SEC13

Sequence
2393 bases(100 bases per row)
CATGTTCagctccacatcgtccaagGCGAGAGCCCCAGCGCCTGTTCTTCCCTGGGTAGAGAAGTAGTAAGTACACACACAGAGACACCATTATCTCTAT
AATATATACAAATACTCATTTAACTGCTTTGTTGTGGTTTCTAGTCGCCCCAAGagcgtggacgagatcacGCACCAGGAGCATGTGGTAGCAACCCTCA
AGACGTCAATTGCCAATGGTCAGCTACCCCACTTGTTGTTCTACGGCCCTCCAGGCACAGGCAAGACATCTACTATTGTGGCTGTAGGGAGGCAACTCTT
TGGGCCGGACTTCCGCAAGAACGGCcgcttcctggagctcaACGCGTCGGACGATCGTGGTATTAAGGTGGTGCGTGAGAAGGTCAAGAGCTTCGCCCAG
GGTGCCATTAGCAGCGCTAGTGGACTGCCAcccttcaagatcatcgtACTGGACGAGGCAGACTCCATGACGGGAGACGCACAGTCAGCACTGCGTCGTA
TGATGGAGAACTACTCCAAGGTCACGCGCTTCTGTCTGATCTGTAACTACGTAAGTCGTATCATTGAGCCTGTGGCCTCCCGTTGTGCCAAGTTCCGCTT
CACGCCGTTGGAGAAGGTTTCTATGGCGTCACGTGTGCGGTTTATCGCTCAGGAAGAGAACGTAAAGGTGTCGGATCCAGTGTTGGACTCGCTCCTTGAG
TGCTCAAACGGAGATATGCGTAAGGCGATCAACTTCTTGCAGAGTGCGAAACAGCTCTGTGGAGACGATGACCTGTCCCAGGACGATGTGATTGCTGTAG
CCGGTTTGGCTCCACctgagctcttgcagcaatttTGGACTTCTGTGGCTTCGAACAGCTtcgagaagatgaagacggacATCGAAAATATTCTTCTCGC
TGGATACCCGGTTCTTACGATTTTGCGGCAGTTGAATGACGACGTGCTGGCATTGGACAAGCTGAACGATGTGCAGAAGGCTAAGATCTGTTTGCGCATT
GCTGAGGCTGACAAAAACCTTGTCGATGGTGCTAGCGaacacttccagctgcttgaCATCGCATCTTACGCCATGCGTGTCTACCATACGTCACCATAGC
TGGTTAACATTGACACAAGACAAGACATAAAATAAAACGGATGGGTCCATGCAAACTGAGATCTTCTACATGTATTCAAGATGAATGCTTGCTACTACCA
AGCCACTAATGTCGTTGAATGGAGGGATTCTGAGTATCTAGTTGCTCGAAGAGTTAATAGCTGCTCCTTGGTCCGTCACTGACGAGATCTGTGCCCACTC
ATGATTGTTGAATTGTTTCCAGAAAGTAacctcgtcgtctccagcagctacgcTGAGAACCGAGCCCGTAAGCGACCAGCTTATCCGGTACACCGGCGCA
TGGAACGTATGCACCACGTGCGATTCCCACTCaccgtcagcttcatcttggctcCACACACGCACTGTGTGGTCGTCAGATCCAGAGGCGATAAGGTTTG
CAGGGATACCAACATTCGGTGCCCAAGCCACATCACGCACCCAGTCGTTGTGCCCGTACAAAGGAGTGTTCACCATCTCCCAGTAACTGCTACCGGTAGC
GCCAGCATTCGCACCTTCCTGTGGCACAGTGATGAACTGCCAAATAGTCACTGCATGATTGCACGACCCTGTAATCACACGCTGAATGggtccttgagct
ccttgcgAGCCTAACGAGTTGTAGGGAGCCCAGCTCACTGACGTGCAGCCCATACCTTCCTCTGAGTTGCGGAAGCTCGACGAAATGACCCATCCTTCAC
GCATACGAGTAAGGAAGGACACCTGTCCATCAGCTGAAGCACACGCCAGACACAATCCGTACTCGTACGGCGCCCAGGCCACACTCAGCACTGCCAGAGC
ATGAAATTCGTGCACATGTTTGAGACGCCACTCCGTCACgttgccagctccagctgcaccCTGTTGCACCAGTTCTTCTCGGTATATGTACACTTTGCCG
TCTTGGGCTGCTAGAGCCAGCACTGCACCGAACTTTGGGTGGGCCCAAGCCACGCGGTGAATGGGCGCAGCCGAGTCGTCCGTCAGAGGcaccacgtgct
gcagcacatGAAGTTGCTCCTGTGGAGTTTCCTGTGCATCCTGTTGGTTTTTAGACGCAGGGTCATCCCCATCTCCACTGGATACAATAGCCTTGGAGAC
ATCGTAGACGCGGAACGTCCTGTCAGAGGAGCACGTGGCCAGCCTCTTGCCGTAGTAGTCTAGCTGGATGTCGTAGATCATGTCGTTGTGCTCCGTGTCG
ATGCTCGTCACTGGAGCTTGGCGAGGCTGTCGTTGTTGGCTCTGGCCAGGGTGAGGTTGGCCATAAGGCGCTGAGAACTGAGCTCCCGCTGAG