Description :
From Genome Similarity Track
Location :
Scaffold_4:35497- 41024
Transcript NameFunction/comments
Physo_332182Hypothetical protein

Sequence
5527 bases(100 bases per row)
GAAGAATACAACTCCTCGGTAGGAGCCTCGGACGCCGACGAAGGAGCAGGAGATTTGGCTGGAACCCGATACGTAAAGCCGCCCGGTGAACTCTCAACAG
CAACTGGATCCTCCAGTGTCTCGCCCACCTCTTCGGTAACTCCAGAGGTGACAGCTTCCTCAGTAGAAGGCATCGACGAACGGATGGAGTACCCGCAGGA
GCGTCATCGACAGACAGAACGACGGGTGCTTCGCCGAGCACCTCCGAGTCGTTGTCAGACTCCTGAGCATGAACCTCCCACTGGATAACCGTGGCGTTCA
ACTTGGCCGCTCGCTGAGGGTACCGGGAAGAAGGCGAAGGGATTGAGTCGACCAGCCCAGTAGAATGCTCAGCAGCAGCAGGCACTGGAGCTTTCTCCTC
AGTCAGCGAACCCTCGCTCGCGGGACTCGGTGACCGTCTCTTCTTGTTCGACGAGCGCTGCTTCTTGGGAGCAGGTGCAGAGCCCTGCTTCGCCAACTCC
GCTTGCCGAGCCTCCTGGATGCGAGCCCAACGAGCCATCCGTCTCTTCTTTGGTTTCTTGGGCGAAGTCGGCGAACTGCTGGAAGCTGGAGCCTCGGTTG
ACTGTGCTGGCTCGTCGTCTGGGTCACGGGAACGACGGCGCTTGGAACCAACGACAACAGGCGATGGTGAGCGTGAGCGATTGCTCGCCGAAGGAGCTGA
AACCGGCGAAGGGAGACTACGCGAAGACGCAGTCGGTGGGGAAACGCTACGAGCGGAATAGCTCAGCGAACGACTAGCCCTGGTCAAGTACCGACCTACG
CTCGACGACCGAGCCCGGAGACGGCGGTCAGCCGTAGGAGTAGCTTGACTCGGCGAGCGAGATCGGACACGGCTCGACGAAGGTGTACGACTTGAAGTGG
AGGCACGAGTGGTGGCCCTGGCCGATGAACGCACAGGACGGTTTGGTGGCGGGGCAGTCGGTGTTGGAGACGGAGTCTGCACGTGCTGCTCCACCTCACC
GAACACACCCAAGCCAGCTTGACGAAGCAAGTTGCTGGCGTCACGAAATGCATCCAGCTGATTGGCTTCCAAGCCAGGCATAGGTTGACCTACAACGCAA
CAAGTTCGATAAGCGACGAAGGGAACACCGAGATTCATGAAGACACCACCCGACTTACCGAGCATAGCTGCGACTGCCAGGAAGGGGCTCTGCTTCTGGA
ATTCGCTGACCAAGGATGTGAACTTCTTGCAGCGAGTCAAGGTCCGGATCTTGTGGTCCTTGTCAGCGAGCTGACGCTTGAGCCACTGGTGCGCAGACCC
ATCTCCCATCAGGATTGCGTCCGACAATTGAGCCAACTGAGTGGAGTGCTCATAGCAACGGCCGATGAGCAGCTGACGATTCCCAGCGGTCCGCCTATAA
TCGTCGACTTGGGTAGCAATAAGCCGATCCTTGTCTCGAATTGTGGCTTCCAGAAGCTGCTTCTCGGCGAGGAAGCTCTTCCGCTCAGTGTCCAGCAGCT
GCATGCTGAGCTGCCCTTCGTTGCTCGAGTCGATAAGGCGAGCCGCCTCCTCCTTGAGTGAGCGGGCCAGCGCATTGGATGTCGCAGCTGCCTCGCGGAG
GGCGGCGATCTCCTTGGCTGCTTCACAGAGGTTGTGCTGCAGGAGGTCAGCGCGCGTGCGCTCAGCAAAGGCTTCCGCAGCTTTCTCGCCAGCGACTGCA
GCAGGGTGAGGTCCATCGACGACCTGGCCTTCAAGCGCTGGCAGCAACTCGTCGATTGACGACGCGTTCTGGAGTCGACGATACAGCTCAGGAGATGGAT
CCACCGGTGGCTTGGCGAACAAGCACGCAAGCAGCTTGCACATTTTGGTCTCTCGCTCGGCCATCTTGTACTCCATCCGATTGCCGCGCAGCTCGAGAAC
GCGCTCCAAGTCAGCGAGAGTCAGCGGTCGTCCCACCGACGCCCCAGATCCAGCACCCGACGAGGCAGGAACCGACGACGGGTCTTCCGATGCAGATGAA
GCATGGAGGTTCTCAACTTTCACATGAAGCGAAGCTCCATCGTCCAGTGTCGCCGCTGGGGAAGCATAAACGGAGCGGCGCGAAGTAGTTGCTGGTGGTG
GGCTTGACGTCAAGCCGACCGCAGCCTGCCACGCAGTGTCCAGAGCGATGCAACGACGTGTGAACAGACAGGTCGACGGGCAAGATGACGAGCGCCGGGG
GTTGTGGTATAGCGAGTTCTGAGTCCGCAGGTCGGTGGTTGCAGTCAGTCCGGGCCGAGTGTGTACACCAGACACCGACTGGAGGAGTTTCGCCGACGCT
GGATCCCAAAAGATCTCAAGGGTCGTCGAGCGAAGAGTCGGCGAGCGAGCAGACTTGGTTTTAGTATTGGAGAGGCCGTAACAGCCCATTTTCATTAGGT
ATTTGTATAGAAACCCCAGGGAAGGGCCTTTGAGCCCAACAAAGCAAAGATAAATACAGAATGGAATTTCCGAGGTCCTAAACAAGCGGCACGCGGCGTC
TCTTCAAGGTACGACCACCCCCCGTGGGGCTAGATCATGACCACCGCTGAGATAGGCTATCCCAAGTGACGGAAGTGTTCTCGGCCGCCCGGCGAGTCCA
AGAGCGAGTGCATGTAGTGGTTATCTGGATTCCGCCCCTGGCGGAGAGCTCGTCGAGCGTACGAGCGCGGGTTTTCGGCCCGCCCCCGACTCAGCCGATG
CGGTTTTGCATCGGCGCCCCGTAAAAGGCGAGAGCCGCCGTCCATCCTTTGGTGGAGGGCACGGGTCAAGGAGAGAAGGAGAAGGAGAAGGAGAAGGAGA
AGAGGCGACAAGGAGAGGTCGGCGAAAGAAGGGGAGCGTGCTCTGTGCACGTGGCACGGCTCCTGGGACGACTTGGCAGGTGCCTGGGTAACCACTGCAG
CGCTGTAAACGGACTGGGCGATCTTCGGATCACCCGACAAGCCTGCGCTCCCGTTAGTGTAGGTGTTGTTGGTGTGGGAGTGGGAAGCTAACGAGTTTTG
GCACGTCTGCTACACCTCAGTTTGGCTCGATAGCTGTGTTAGGGCGTAACTAGAGCAGCGCGACTGTGAGTCGGCACCTCGAAGCAGCGAAATGCCGTCG
CCACGGACGATCCAACGTGCCCATCGATCCGAGCTCTCTGGGCTCAAATCACGCCGTTCGTGGCCAAGCTGTGGTGCTCCACCGGACGCCAGAGGCCGTG
GCTTCCCCACAGATAACCTCGAGGCGCTCGAAATGCCAAACTCGGGTCAGCACGCCAGTGTCAACCGGTCGCCAAAAGCAGTAGGTTCCTGGTCTCGATC
CGCCGATTTCGCCGTAACCAGGGGTCCGTGGCACGGCAGCGGTGGCGACTGGCTACCGCAGTAGGGCATGCGATGGTGCTGCGCGGCAAAAACGCGGGCG
GCAACGATGCCAGCGTGCGGAGCAAAGACGGGGCCTCACCGGGAATCGAACCCGGGACCTCTCGCACCCGAAGCGAGAATCATACCACTAGACCACGAGG
CCACTCCAAACAGACCTAACCGCCTACAAAATTAAAAACGCCATTACGCAAAGCCGCCACGAGCTATCTACGCACACGCACCTGTGCGGCACGCACCACA
TCCACCGCTACCTGCCCGTACCCTCCGATCTACAACCGCATCCGAAATGCCGTCGCCACGGACGATCCAACGTGCCCATCGATCCGAGCTCTCTGGGCTC
AAATCACGCCGTTCGTGGCCAAGCTGTGGTGCTCCACCGGACGCCAGAGGCCGTGGCTTCCCCACAGATAACCTCGAGGCGCTCGAAATGCCAAACTCGG
GTCAGCACGCCAGTGTCAACCGGTCGCCAAAAGCAGTAGGTTCCTGGTCTCGATCCGCCGATTTCGCCGTAACCAGGGGTCCGTGGCACGGCAGCGGTGG
CGACTGGCTACCGCAGTAGGGCATGCGATGGTGCTGCGCGGCAAAAACGCGGGCGGCAACGATGCCAGCGTGCGGAGCAAAGACGGGGCCTCACCGGGAA
TCGAACCCGGGACCTCTCGCACCCGAAGCGAGAATCATACCACTAGACCACGAGGCCACTCCAAACAGACCTAACCGCCTACAAAATTAAAAACGCCATT
ACGCAAAGCCGCCACGAGCTATCTACGCACACGCACCTGTGCGGCACGCACCACATCCACCGCTACCTGCCCGTACCCTCCGATCTACAACCGCATCCGA
AATGCCGTCGCCACGGACGATCCAACGTGCCCATCGATCCGAGCTCTCTGGGCTCAAATCACGCCGTTCGTGGCCAAGCTGTGGTGCTCCACCGGACGCC
AGAGGCCGTGGCTTCCCCACAGATAACCTCGAGGCGCTCGAAATGCCAAACTCGGGTCAGCGCGCCAGTGTCAACCGGTCGCCAAAAGCAGTAGGTTCCT
GGTCTCGATCCGCCGATTTCGCCGTAACCAGGGGTCCGTGGCACGGCAGCGGTGGCGACCGGCTACCGCAGTAGGGCATGCGATGGTGCTGCGCGGCAAA
AACGCGGGCGGCAACGATGCCAGCGTGCGGAGCAAAGACGGGGCCTCACCGGGAATCGAACCCGGGACCTCTCGCACCCGAAGCGAGAATCATACCACTA
GACCACGAGGCCACTCCAAACAGACCTAACCGCCTACAAAATTAAAAACGCCATTACGCAAAGCCGCCACGAGCTATCTACGCACACGCACCTGTGCGGC
ACGCACCACATCCACCGCTACCTGCCCGTACCCTCCGATCTACAACCGCATCCGAAATGCCGTCGCCACGGACGATCCAACGTGCCCATCGATCCGAGCT
CTCTGGGCTCAAATCACGCCGTTCGTGGCCAAGCTGTGGTGCTCCACCGGACGCCAGAGGCCGTGGCTTCCCCACAGATAACCTCGAGGCGCTCGAAATG
CCAAACTCGGGTCAGCGCGCCAGTGTCAACCGGTCGCCAAAAGCAGTAGGTTCCTGGTCTCGATCCGCCGATTTCGCCGTAACCAGGGGTCCGTGGCACG
GCAGCGGTGGCGACTGGCTACCGCAGTAGGGCATGCGATGGTGCTGCGCGGCAAAAACGCGGGCGGCAACGATGCCAGCGTGCGGAGCAAAGACGGGGCC
TCACCGGGAATCGAACCCGGGACCTCTCGCACCCGAAGCGAGAATCATACCACTAGACCACGAGGCCACTCCAAACAGACCTAACCGCCTACAAAATTAA
AAACGCCATTACGCAAAGCCGCCACGAGCTATCTACGCACACGCACCTGTGCGGCACGCACCACATCCACCGCTACCTGCCCGTACCCTCCGATCTACAA
CCGCATCCGAAATGCCGTCGCCACGGACGATCCAACGTGCCCATCGATCCGAGCTCTCTGGGCTCAAATCACGCCGTTCGTGGCCAAGCTGTGGTGCTCC
ACCGGACGCCAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNN