Description :
From Genome Similarity Track
Location :
contig_38:354917- 363243
Transcript NameFunction/comments
g7129.t1H - or Na -translocating F-type, V-type and A-type ATPase (F-ATPase) Superfamily
g7130.t1hypothetical protein PHYSODRAFT_309093
g7131.t1hypothetical protein
g7132.t1hypothetical protein

Sequence
8326 bases(100 bases per row)
TAGACGTACCGTAGTTGAGAAAGAGTTCTTCTTCATCTACAATGTCAGCCGTTGCGACGAATGCTAGGCCCTGATTTCAACACAGGAGGTAATGTCGTTA
ATTTATAATGGACAGGAGCGAGCTTTTTTCTGAAAGGAACTTACATGCACGATTGCACGTTTGCCAAACATGGAGAGGCGTGAAGGCTCTTTCACAAAAC
TGTTTGGAATAAGCTCGTCGAATTCCTTTGTCGTGAATGGTTCTGCAAAAGACAGAGTACCGTGGTTAGCACCCACAAGTCACGAAAGGAGCTACCGGTA
ACAAAGCTAATGAAGCATTATCAAACCTTCGAGTGGGAACTCAAAACCAAAAGCAAGCACATTAGGAGGAGTTCCGCTGGGAGGGTGGTTAATCTTGTGC
GCCACAGCAAGAGGATTGCTCGGCTTGGAGGCTGGTGGACATTCAAATTCTGTCAGTTGTGCTCTGGGGGAAGAGAACGGATCCACTGTTGCAATATAAG
CACTCTGTCACGACTGGCACGCACATTCGTTCTTGGCGTCAATAATCACACTATCGAAGCGGGCTCGAGCGAATGGGTTGTTTGACAACTCGCTCAGGTA
TTGTTTCTAACACAAGGGAAAAGTTAGATTTAAAGCACCGATGGTCCAGCTAATATCCCAGCAGCTTCACCTTTTTGTAGTGCAGGTAAGTAAACAATGC
CCGGGTACAGTGCCTGTTACACCCAAGCCGTGCATAGCATAAGATAACACAGCACAACATCAAAAGTGTAGCTAACCAGTAGCAATTTCGTACCACTAGG
GACCCGATGGAAGCAGCACCGCGAAGTTTAACGCCTTCCCCCGCATCAGGAACGCTTGATTCTTCCACGTTCAAAGTGAATCCGAACAGCTTCTGGAAGT
CGCCAGTGATTCCAAGCTAGGCCGGTAACACGCGGGTGAGCCAACTCATCATCCCAGCAAAGGGTTATTGACACCTTTCGCACCTTCTCGCCCACTTCAG
TGTTGCGCTCGAAACCTGACAACGACATCTTAGGCGCGTTCTTCTCCGACTCCTTAGGCATCCGCAGCACAGCGTTAAAGCAGCTCTGGACCTGTTGACA
ATAGATATAGCCTGCGATTCAGCACAGATTTTGCTGCAGTCCAGCTACGTTATCTACACCCACGCACCTGCTTGCTGAGTTCATCTTGCACATACTGCTT
CTGCTGTTCGAACTTCTTCTTGCCTACGATCTCCACGGCTTGGTCGAACAGCTCCCCATGCTCTCTGCACAGAGCACACGAGATTAATATAATCCAAGTC
ATCTGTGCACAATTGCAGCATTAGAGCGCAACTCACTTGTCCGCATTCTGCGGGTCCAGCTTCAAGCTCCGGAAGCAGCTCAGCACCGCGGCCACGCCCA
CGTCCGCCTCCTCCTGCTCATAACAACGTTAATTAAAACCAACAGTTCGTCCCTGTAATGCTCTTAACACACTACAACGCGATGCAACGCACCTGGAAGC
GCCGCGCCGGCGTGGTGCCCGCGATTCGGAGCTGCAGTCGGCGCCACACGCTCGTCATTTCGTTTTTGCACATACTATGGCGTATGCGAGGCTTAGGCTA
TACAATGGGCTGGCCAAAAGTGCGGCGCAAAATCACACCTGAAAATTGGCTAGAGGGAGTGATGGCGAGCACAACAGCAGCGAGACGCCCAAGCCTGCGG
CCGAGGACCCACCTCACCCGTGGGGCCCGCGCATGCGTATCGGCAAGGTCTTCCTCAAGGGCAACGATCGCACCAAGTACGCGCGACTCGTGATTGATGA
TGGTGGTATCCAATCAAGCCTGACAATTGGGTTCTGTTTCGTGTGAGTACAGGCCGGAGGTATTCGAGAACGAACTCCAGGTACAACTAAGTCATGCAAC
AGTTGATAGTATATATATCTACTGGTGCGAGGATCTGACAGACACGGCGTACTCAATCTGTAGGCGGCGTACAGCGCCGAACGGATCGGCCAGTTGGTGC
ACAAGCTGGAGGAGGCCACGGAGGAGTTCAGGGCGCTCGACATTTTCGAGTCCATCAACATTGAGCTGGACAAGGGTGAGGACGTGTATTCAGGGTGGCT
GCGGATTGACGAGCTAGATTTTGACGTGGTGGTTTGATGCGGTTGCTGCAATCACAGCGAGCTCTGGCCAGCTCGATGAGACGGACCTGACGATCACGGT
GAAGGAGAAGGGCTGGCGATCTCTGCACGTGGGCGCAACCACCGACGGCAACGACGAAGCAGGAGTACGGTGCATTTAATTAAAGAATCGGCGCGTAGAG
ATGGACTGCTAACAGATGATGCTCTTTGTTTGCAGGAATCTTCGCTCACGTTGTCGAATGCCCTCGGTGAAGCAGAGAAGATCACGCTTAGTGCCACTTA
TGCGCGATCGGGCAGTAACACCCAGCGCGCGACGTTCAAGAAGCCGCGCTTTTTTGGTCTACCGCTGTACCTGAGCGCCGTTGGCACCAACGAGCTCCAC
GTCAGTAAAATTGCTGTGCTACTGGATTTGTTGCAGACTATGTCGTCTGATTTTACGGGGTATTGCTTTTTCAGAACCAAGAGTGGCTGAGCTCGTACAA
CGAGAAGATTCGTGCTGGTAGCATTTCGATCAGCGACTATGAAGGTGTGCACGACCTGTCATGAATGTGGGTTGGCGCGACCTGCTTCCGCGCCGAGACT
CCAAGATTCCGACTGCGTACCGTGCGTCACCGAGTATCCTGGCGGAAGCAATGCCGTCCACGAAGACCAGTGTGAAATATGTGTTCACGGACGACAAACG
GAACAACGTTGTGTATCCGACAGCTGGAGGCCTCTTCAAGTACACGTACGTGACTTGGCAACAGATCCATTGCACTTGCAGCAAAGGTTCAGCTGATCTA
ACAAGTTGTCTGCTTGGTGCTTCTTAGTACGGAGATTGCTGGTCTTGTGGGCGATGTGAAGTTCGTGAAGGCTGAGGTGGAGGGTCAGAAGCACGTTGCG
CTGGGCCCTGTTCTCAATGGATTCCCGATCCTTAACTTCAGCCTTTCGTACCACTTGGGAACGGTGAAGTCGTATGGTAGTGAGCAGAACCGGCCAGCAC
GCATCAGTGACCGCTTTTTCCTGGGTGGCCCCATGAATGTGCGTGGCTTCAACCACAAGGGCATTGGTCCTCGGGCTTCTCCTCTTGATGGCGGGGTTGC
GCAAGGTGATGCGCTTGGTGGCGACGTGAGCTACAACGGAACTGCAAGCCTCGGCTTCCCTGTTCCTTTGCCGCTCTTTGTTGTAAGTCTGTCTTGCATG
AACCAATAACTTTGTCCGTCTAATTCACACTATCTTCGTGTGCTTTGATGCTCAGGCGCTGGGTCTCCGCGGACAGTTTTTTGCTAACGCTGGCAATCTA
ACGACGTGGGACCGCCTGCTTGATGAGAAGAAGTGGCTGAAGAACCTTACGGACGACACGCGTGTTTCCGTGGGCATGGGTCTTGTATGGGGAACCCGCA
TCGGCCGCCTCGAGGCCAACTACTCGTGGATTCTCAAGGCGCACGCTCATGTAAGCTCTCGCTTTTCTCTCTCTGGCAATTTGATGTTGACTAATTTTCG
CTACTGTCAGCAGGATAACATCAAGCGCGCCCAGCTTGGTCTCGGCATGACCTTTTGCTAACCGTAGAGAGTAAAGGCAAAGTAAGGAGGGAGGGTTGAC
GAAATACACTGGCAGCATCAGCTCCCAATCCACTACATGTAGTCGCTACCATGACGAATTATTAATAAGGGGCTAGTTACGATTGACCCCTAATTCGACT
CTCTTTTAGACTGGATGATGCTCCAAGGAACCTACTGACCAGAACCCAGGCCACTCACTGAGATCTGCCGCATCGGGAAGAGAAGGTCTCCACTTCCAGT
CTCTTCATCTCTCAAGCAGCAGCGCCATGTACTCGGGCAACGCGCGCGCATCTACAACCCGCAGCCGGATCCGCTGGAGCGCGGGCCGCCCAAACGCGTG
CTGCGCGAAGAGCAGCACATCGGCGAGATGGTGGCGGCCTCCAAGAAGCGCGTGACGTGGCGGTTCACGCTGGGCGACTCGGACCGCACGCACGAGGTGG
TGCTGGTCCACTCAGTCATGAGCTACAAGAAGGTGCGACTTCTGTGGCTGGTTAGGCGCTACTTGAAGTGGATGACTGATGGGGAAGCGCTTTGGTGGTG
CAGGTGGTGCAGTATGACGGCCGACAGATGCATTTCTCGTCCACGGTGAGGAGATAATTTTTGATCATGTTTGGGGGATTTGGTTTTTATCGTGATGTGT
GGTGATTTGTTGTGCTGTCGTTCGTGTAGGCGACGTTGGGCGACTGGAGCTTCTCAATGGTTTTGGACGGACTCAATGTGGTTATGGAAGTTCGTATCAA
CGACATGGAGTCTGCTGACGTCCCGAAATATGGTGTGGTTGGACTTTCGCCACGTGCAAGGAGGACGAGCTAATCAGGATGTACCTGCGTGTGTTATGTG
TCATGCTAGACTTCGTGATTGATCGGATCCCGTTCCGTCGCTGGGATGTCTATCGCCGCAAGAAGCACGGGATCACTACCGCTACCTATGCCCAGCCGAA
CGCTCCTTCCGGAAGTACGTTACGGGCGTATATATTCACAGCGTTATATTTTTTTAATGATAGGCATTGTTGACGTGTGATCAATGTTGTGTGTCAATTA
GATGCGTACGGAACGCGCCGGTGGGGCCTGGCGGAGCGACGCAAAACGAGTCTCAGTCGTCTCACGGCTCCTTCACGAGTAGCAATCGCGAATCTTTTAC
CGGTAGCTCTCGAGGATCCTTCACGGGTAGTTCTCCTCCGCCGGATCGTACGCAAAGCTTTGGACAGCAGGGTGCTCGTCCGCGAACGTCTTCGGGACAG
CAGAATGGACGCACTCGCAGCTTTTCGGGACAGCAAAATGAACAGCAAGGGTTTCAGCAGTACGGTGGACAGCGCTCATCGTTGCAGGAGCAGAGTGCAC
CGTTTGCTCCTAACCCAGCGCCTACGAACGCGCACCGTCAGCCACCCCCGGCCCCGCTGCACCAAAGCCGAAGAAGCAGCCCGAGATTAATTTGATCGAC
GACTTTGGCCCCAGCGTGAGCGTGTCGGCACAATCGTTGATTTTCGATCCTTTGGCCAGTGTAAGTGCAGTTTCACATGAGTATTCGTTTGCACAGCGAT
GATATATCTCACATCATAATGTTGTGAATCCTAGGCAAAGATCTCAGCGGCTGGAGACTCTGTTGCCACAAGCGTACCCGCGCCGCACCAACAGCAACAA
GCAGTCCCAGTCGCTTCTATCCCTCAGCAAACCAACTATGTGGACCCGTTTGCTTCTGTCGCTCCACCCACACCGACGAAGCCCGCCGGAAACGTCAATT
TGGATCCGTTCGCAACGCACAATACCGGCAACTTCCAACATCAACAACAGCAGCGCCCAACTTCTATGGGTAATATGACTCAAGCATACACGCAGCAACC
TATGGGTATGGCTATGGGTGCGCCTCAGGGTGGAGTGCTGATGCAACAATCTCACCAGCATGGAATGCGAGGTTCTTTTACAGGGCCGCAGCCCGGTGCT
CCCAGTGGCATGGGCAACGTCAACTACAACATTTCGCAACTCATGAACCCGGCAAGCCTCCAAAACGGTCAGCAGAATCAGCAGGGCAAGTCCATTAACA
TTGATGCGTTCGCTAGCTTGGGCCGTTAGTGCCAAGCGGCTAACAAGCGATGCACAGACGCATATTTTGATGAAGCACCTTTGTTCCTATCGCGTAATAT
TCGTACGGCGTCGATGTTTACCATTGCCAAGCAGTTCACGTGTTTCCCGATCTATCTGGCTTGTCATCTGGAGCCTCATCTGTACACGGACATACTCAAC
CTCAGCTTGCTTCTTGGCCTCGAGATTTTCTTTCACCATTTCAAGGCGCTGGGCATGCTCCAGCTCGATGAGCTCGAGCTGTCGTGCGTACTGGGCTGAA
AGTACCTGCACGTGGTCCTGCAATCGTTTGTCTGCTTGTACGGTCCACTGCTTCTCCTTCAGTTTGATCTCGGCGGTGTGGAACGACTGCAGCTCGTTCG
TGCGTTTTGTTAAGGTCGCCGGGGCACTCTTCGCTAGCTTACGCGCGCCGCGATCACCTGGTCGCACATTACCAGATGATGTTGCAATTCTTGCTTGCAC
GCGTCCAGTTCGGCTTGGAACTGCTCAGCCTTGCACGCGGCGTCGTGGTGGTACAGGAAAACACTGCGCAGCTCGAGCTCCACTTTGCCGAGCAAGCGAT
CCAAGTTGGCTCGAAGCACGGCAAAGCCCTCGAGCTCTTCGAAGTCCCGGAAATGCACCCGCACGCGACCCTGCGCTCGCAGGAAGAGCTGCTCCTCTAC
GAGCGTCAATCGCACGCTCTGTTGCACTTGCATCCCGCGGCTGAATCACGCGTGACACAGTAACGATTCCCGCGACCGCCGGTTATGAACCGTTATTTCA
AGTGCACATGAAAGCCGAAAATGAACGTGTGCTTCAGGTGACAGAAATCGGCTATGGCCTCTATTGGAATAATTTACACCGCGCAGCAGGTGCGCTGCGA
CTTGTTCGGTGGAGCGCTGTAGTCGTCGCGCGCCTTCTAGTTTACTGTACGCCACATCCAGTGTCGTTGGTGCTCCAACGCATGGCCGACGTGTAATTGC
GCGTGGCCTTCTCGAGCGCGATGAGGTGCGGGTCGCGGACCTGTAGAGAGCGCATGCAGTCGCAGAGCTTGAAGAGGTACTCGAAGTTGGGGCCGCTGAA
GCCGCTGCGGGTGGCGATCTCCTTGGCCATCTCGTCCACAGACGACGGTCCCAGGAAGTCCGAGTTGGTGGGCGTGGCGATGTACACGAGCGCTTTACGC
ACCACGCCGTCCTCGCAATGGACATCGACCATTTGGCGGTCGTAGCCGGCCTGCTCGCGGTTGTCGAGCTTGGTGAGTGTGTCGGCAACCTCCTCGTCCG
GCACCTTGTAAAGGCGGCCCCACGTGATGTGGTCGCCCGCCAGGTGCGCGTACTCGTCGTCGAACTTCTTCATCTCCTCGCGGCTGATGAGCGTCACGAC
GCGGCCCTTTGCCTCGGGCGAGCCGCGGTGGTCCGGGCTGCCCTGCCAGAAGCGGCGGTGCCAGCCTTCGACGTAGCCGAACACCGTGTCCTCCGCGGGG
AACTCAGTCTTCCAGACAATCGATCCGTAGCCAAAGACCCACATGGTTTCTAAATAGGAGCGGAGGTCTTGAAGACTAGTAGCTGCTGCTTGATGTTGCC
GCGATGGAGGCGAATTCCAGAATGAGCTCGGTGGCAAACAAACGCCCAGCCGGGTTGCCCTATCCTGGGCCAGGATTACTTGCCCTACCCACACCGTTCG
GTTGTTTGAGCAAAAAGCTGCCTCAAGAAAATTCCGCCTTGCTGAGCCTGTGACGCGGTAAATCATGGGAAATCTGAGCGAGCGCGGCCCCAGTAAAAAC
GCACCGGGGGGCATCCTGCGCAGGACCCCGATAGCCGCAGCAGAGTGACCTGCAGTCTCGTGCAAGTACCGCAAGACAGCATGTTTATCCGCTCATATTG
AGCTCGAGCTCGAGCTGGCCGTTGTGGTCAAGATATCCACCGGCAGGCAACTCAGGATTGAATCCTGGCTCTGCAGGCAGCAGTGAGGGCCACTCATACC
GAGACGCCATCCGTATCATTTGCCGCAGGACAGCCGCGCCGATCTGCTCGGGCGAAGAGAAGCGGAGGCGTGACCGGATTGGGCCACGTGCATCGAGAGC
GTCCTGCCAGCGAGTGACGTGCACGGCCGACGTTGTGCCAGCCCGGTGCTGTCAAAGTCGGTTTTTTTGCCGGAGCGACGCTTGTTTATGCCTCAACTGT
CCTGCTCTGTCCAGTAACGTTTCGGCGACCAATGAGAGAGGCGTATCTTGATGACTAGAGGTGCACCTTCACCTTATTTGATCGTACTTAAGAGCGTGGT
GGTACCTCTCACGCTGATTGGACATTCCGCTTAGGTACGGTTGGCCAGTGTTCCACCTCCCCATCCCCCTTCAACACCAGAATTGGTGACGATCTCATGG
CGGTCACCAACGGAGCCCGAGCGCCGGCGCTGATAGGCCCCCGCTGGTGCAGAAGACCCGATTGGCGACCCCGTGCCGCCGTCACACCCGGATGGACCTC
AAGCAGCCGTCGCGTGGTTGTCGCCGCGCTCTTGGTCACTGGAGCGTTAGCGGTACAGCCGATCAAGCAAGCCTGCAAGTCGAGGAGGAAGCCGGGCGCG
GCGACGCGCAGCGCAGGGCGGTTGAC