Description :
From Genome Similarity Track
Location :
Scaffold_70:35487- 38651
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_70-fgenesh-gene-0.18Ubiquitin-activating enzyme (E1)
Pytir_DAOMBR486maker-pir_contig_70-fgenesh-gene-0.19Microtubule-associated protein, RP/EB family, member 3 isoform 4

Sequence
3164 bases(100 bases per row)
GCAACGCCACGGCTGCAGTGCGCAATGGGGCAAGGCAAGCAGATGGGGTGTTAGGATTAGGTGGCTAATGACACAGACTGAAGCATTCTTGTTTGTATTG
AGTGTGAAACGGGTGAAACAGCGACTCACAAGAGAATGGATGCGAACCAGATTGTGGCAGTATCCGGAACACAATGAAGGATAACACATGTCGCAGAAAA
CGTCACCATTATTGGGGGCACACCACAACGAAGTGCATTCATTATTCATGTATGATTGCTCTATTATCAATGGCTGCTTGTCAGTCTATCTCTCTCTCTC
TATGGCCACTCGCCAAACTTCTTCAGGCGCGTGTCGATCTTGTCGCGCACTTCGTCACCAAAAGCATCGACGCTGCCATCTAGCTTGTCGAACAAGTTGA
GCTCCTTGAGCGTGAGGAACACGACGTTGTCCGGACGCAGCGGCAGGTCCTTTCGCCAGCGCGCGAGGAACATGCGCTGGTGACCGCCCTGGCGCACGCC
GCTCACGGAGCTGCGGCCGCGCCACACCTCCTGGAAGATGAACTCGATCTCCTCCTTCTCGAGCTCCATGCGGCCGCTCTCGATGCCCAGCACGCGCTCG
CGGTCCAGGAGCTTCTGGAAGAGCTTGTTGCGCTGGTCACGCGACAGGCGAGCGATCGCTTCCGGCGCGAACGGTTGGCCCGCGAGGTCGCAGAGCACGT
ACGCAGCCATGGTCTGGCCGAAGAGCGCCGGCATCGTCCCCAGCACAGGGATCACGCGGATGCGGAAGTTCTCGACGCTGCCGAACTCGGTCGGATTCTG
CGCCTGCTCAACGTCCAGTGGCAGCAGCTTCACGACGCTCTTCTCGCTCGAGAACACGGTCGTGATGCGCGACGTCTCAACGCCGTTCTTGGCGAGGAAG
TAGCGCATCTTAGTCGCCAACGGGTCGCCTGACCTCACGCATACAATGCAAAACAAAACAGCGTCAGACTGAGGTTATATACGCACAAATGGACTTCTCG
TCAAAAGACAACATGATAAATACGTACGAACAGCGTCCTTCATGGATCCGATCTGCAGGCGCGTCGGGTCCGCCTTGGCGCCGGCGCCCGTGGCTGTGAT
GACCTTGAGGTTCTTCTTCGACACCGCGACGAGAAGCGCCACCTTGGTGGTGACGTCGTCGATGCAGTCGAGCACGTACGTCGGGTTGCCCTCGAGCAGC
TCGTCCGCCGCGGCTTCTTCGAACATCACCGCGACGTCCTCGATCTCACACTGCGGCACGATTTCATGCAGGTGCTTCTTCATCGCAGTCACCTTTGGGG
TGCCCACGTCTGCGCGCGTCGCGACAGCGTGGCGGTTGAGCGACGAGAGCGTCACGTTATCGAAGTCAATGAGGCGCAGTTTGCGCACGCCCGAGCGCGC
GAGCATGTGCGCGGCGTGCGAGCCCACGCCGCCGACGCCCACGACAATCACGAACGCGTTCTGGATCTTATCGAAGCCCTCTTGGCCGAAGAACGTGTGG
ATGCGCGACAGCTGCTCTTGCAGCAGCGCGTCTTCCATGGCGTCCGTGCCCGTAGCGCGTGGCGCGCTTTCGCTGAGCTTGCCATTGCCGATGACGCCAT
ACTTCGCGCCGCTCTTACGCGGGACCGCTTGCTTCTTCACGATCGCAGTGTACACCAGCTGCGCGGCGACCGCCGCTGCCGCACCGATGCCGAACGCCGC
CGCGAGCTGCAGCTTCTGCTCTCCGAGACCCAGCGTCTTGACCATTTTGCCACCCACTCAAGCTACTTTCAATCTGCCAATGAAGCAGGCGGCAGTCAAA
GAAAGCTCTTCGCAACTCAAAATGCTCGCAGCCATGAACCGAAGTACCTTTTTATCTTTGCACAGATAATAACTTCTATTGATTTAAGTATGAGAATGTC
TAGTCCTCTATAGCTTCGATTGGCTCTTCGAGCTGGGTTTATATCTTGATTTCAGTATGCAGGTGCCCAACTCGTCACACTATAAGGAGGGTTTGGCCCA
TGGTGATCAACAACAGCCAGATCAGCGCAACTTCTGAATATCGGGACTAAAAAAGCTAACCTGCCACGAGCTCCTCGATAGCTTTCTCCAAGTACTTCTA
CGCCATCACCAGAGCCCATTTCCAATGAGATCACCATCCACAAGCGAGTACAAACGCAAGCAAAGCACGCACCATATCCTTTGCTCGTCCCATAAGCTCC
GCCTCCAGCGATGCAATCTGTACTCAGGTCAAGTCCAACACAAGAGAGAAGCTCACGCCACTAAGATGATCGCCACAGGTCCAGAACCTACAAGCTTCAA
CGGCCGTATCGTACCAAATCTGAGATCCGCATGCAGACGAATGGATCCGCAGCGTTACTTTCGGCAGCACCGTTGGCGGCGTCTTTGTCCACACCCTTCT
TCTTGGCGAGTCCAAGCGCTCGAGGGGCTTTCAACCTGCTAGCTGACGCCATTGTCGCCATCGCACTTGTATTCGTCTTGCCTTTCAGATTCTTCGACTT
TGAGCCACTGCTGCACTCAGTGAGCGCATCCATGCTTCGTGAGAGCTGCTCGATACTCAACACCGCCTTTAGCGTGCTCTTGAATGAATTTCTACACAAC
ACCACCAGTCAGTCTGTCAGTCAGTCTTCCGTAAGCACACCCATTTTTCACTCGATCTCAAGCAAGAACTTTCTCCACACTTGACAAACTCCAGCGAAGG
GTGCAGAGTTTCAACTTCAGTGGTGCTTTCGCCACTGAAAACAGTGCATTCTGGTGTCGCTCTTTCCTTGAAATCGATCTCCGAGCTGTCTCCTCTTTGA
AATCCCGAGTCTTTCATTTGCACAGCGTCCTCCTTGCAATCTGAACTCCCGAGAAACGAGTCTCGCCGAAGCAGCTTCATCGTATTCTATGGCAACCCAG
CAACACCATTAGCAGCATGCCCAAGCCATGCGCTGCTCATTATACACAGGATATCAAGATCTTTACCGAGTACTTTGGGACCAAGTTCGTGTTGGCGTTG
TTCAGTTGCGTGAGCGAGAGCGTCGTCCCCAGCACTTGCTGCCGACGCTCAAAGCCGTGATATGACTTCATCACGTCTGGGTATGTGCGGTGCACATAGT
CGTGCACCCAATGCAGGAACTCAAAGTGTTCCTGGAAGATGCCCTCGACCAGCTTGCGCACAGG