Description :
From Genome Similarity Track
Location :
scaffold_38:354859- 363202
Transcript NameFunction/comments
g12752.t1 H - or Na -translocating F-type, V-type and A-type ATPase (F-ATPase) Superfamily
g12753.t1 hypothetical protein PHYSODRAFT_309093
g12754.t1 sorting and assembly machinery component 50
g12755.t1 hypothetical protein PHYSODRAFT_477719
g12756.t1hypothetical protein

Sequence
8343 bases(100 bases per row)
CATTTTCTGTGAAGCCACTGCCATCTACGGCGTCATTATCGCTATCATTCTGCAGAGCAAGGTGTGTTCTCATTGCTGCACTGAGAGCAGTGTGGTTGTT
ATGTGGAGAGTGCTGATTGAGTGCGTGCTTAAATAACTGGGTAGATGAACCAACCGGCACTCCGTAACGAGGGGGATGAACCGATCAATGAACACGCGCT
GTACTTCGCAGGATACGCCGTGTTCGGCTCGGGTCTTGCTGTTGGCTTGACGAACCTTGCCAGCGGGTACGATCTTCGCGTATAACTTTGTAGCTTGTGG
ACGGGATGGTGAGACTCACCTGTTGCTTGGTGTAGAATTTCCGTCGGGATCGCTGGCAGCAGTTGCGTGCTTGCTGATGCACAGAATGCTGCGCTGTATG
TGACGATTTTGATTGTGGAGATTTTCGCTAGTGCGCTGGGCATCTTCGGTGTCATTGTCGGCATTATCCTTTCCAACAACGCGGAGTTCCCTAAGTAAGC
AAAACTATGAGGACGAGGAGACCGTGTTTAAGCACAAGGCCATACACGCTACACTATCTCGGCTATCCTGATGCGATTTGTGTGTGATTGCACCTAGCTC
AAATTTACCATTTAACCACATCAATGCATTTCCTTTCTTCTCATTCTACTAGGCTACTAGAATCATTCTAGTAGCCTATGGCAGAAAACGTCTCAATCGA
AGCCAAGCCTTATTTCCACATTGCGCGGTCGCTATCAACGTCGACAGGTGCATACCACTTGGGCAGTGAGCGATCGGGGTTGTATCTGGTTCACCAATTC
TCAGTGTGAGTACAGTACTGTGTTGCAGCAGCGGTAGTTGAGATTGGAGGATAGACGTACCGATAGTTGAGAAAGAGTTCTTCTTCATCTACAATGTCAG
CCGTTGCGACGAATGCTAGGCCCTGATTTCAACACAGGAGGTAATGTCGTTAATTTATAATGGACAGGAGCGAGCTTTTTTCTGAAAGGAACTTACATGC
ACGATTGCACGTTTGCCAAACATGGAGAGGCGTGAAGGCTCTTTCACAAAACTGTTTGGAATAAGCTCGTCGAATTCCTTTGTCGTGAATGGTTCTGCAA
AAGACAGAGTACCGTGGTTAGCACCCACAAGTCACGAAAGGAGCTACCGGTAACAAAGCTAATGAAGCATTATCAAACCTTCGAGTGGGAACTCAAAACC
AAAAGCAAGCACATTAGGAGGAGTTCCGCTGGGAGGGTGGTTAATCTTGTGCGCCACAGCAAGAGGATTGCTCGGCTTGGAGGCTGGATGGACATTCAAA
TTCTGTCAGTTGTGCTCTGGGGGAAGAGAACGGATCCACTGTTGCAATATAAGCACTCTGTCACGACTGGCACGCACATTCGTTCTTGGCGTCAATAATC
ACACTATCGAAGCGGGCTCGAGCGAATGGGTTGTTTGACAACTCGCTCAGGTATTGTTTCTAACACAAGGGAAAAGTTAGATTTAAAGCACCCATGGTCC
AGCTAATATCCCAGCAGCTTCACCTTTTTGTAGTGCTCAGGTAAGTAAACAATGCCCGGGTACAGTGCCTGTTACACCCAAGCCGTGCATAGCATAAGAT
AACACAGCACAACATCAAAAGTGTAGCTAACCAGTAGCAATTTCGTACCACTAGGGACCCGATGGAAGCAGCACCGCGAAGTTTAACGCCTTCCCCCGCA
TCAGGAACGCTTGATTCTTCCACGTTCAAAGTGAATCCGAACAGCTTCTGGAAGTCGCCAGTGATTCCAAGCTAGGCCGGTAACACGCGGGTGAGCCAAC
TCATCATCCCAGCAAAGGGTTATTGACACCTTTCGCACCTTCTCGCCCACTTCAGTGTTGCGCTCGAAACCTGACAACGACATCTTAGGCGCGTTCTTCT
CCGACTCCTTAGGCATCCGCAGCACAGCGTTAAAGCAGCTCTGGACCTGTTGACAATAGATATAGCCTGCGATTCAGCACAGATTTTGCTGCAGTCCAGC
TACGTTATCTACACCCACGCACCTGCTTGCTGAGTTCATCTTGCACATACTGCTTCTGCTGTTCGAACTTCTTCTTGCCTACGATCTCCACGGCTTGGTC
GAACAGTTCCCCATGCTCTCTGCACAGAGCACACGAGATTAATATAATCCAAGTCATCTGTGCACAATTGCAGCATTAGAGCGCAACTCACTTGTCCGCA
TTCTGCGGGTCCAGCTTCAAGCTCCGGAAGCAGCTCAGCACCGCGGCCACGCCCACGTCCGCCTCCTCCTGCTCATAACAACGTTAATTAAAACCAACAG
TTCGTCCCTGTAATGCTCTTAACACACTACAACGCGATGCAACGCACCTGGAAGCGCCGCGCCGGCGTGGTGCCCGCGATTCGGAGCTGCAGTCGGCGCC
ACACGCTCGTCATTTCGTTTTTGCACATACTATGGCGTATGCGAGGCTTAGGCTATACAATGGGCTGGCCAAAAGTGCGGCGCAAAATCACACCTGAAAA
TTGGCTAGAGGGAGTGATGGCGAGCACCAACAGCAGCGAGACGCCCAAGCCTGCGGCCGAGGACCCACCTCACCCGTGGGGCCCGCGCATGCGTATCGGC
AAGGTCTTCCTCAAGGGCAACGATCGCACCAAGTACGCGCGACTCGTGATTGATGATGGTGGTATCCAATCAAGCCTGACAATTGGGTTCTGTTTCGTGT
GAGTACAGGCCGGAGGTATTCGAGAACGAACTCCAGGTACAACTAAGTCATGCAACAGTTGATAGTATATATATCTACTGGTGCGAGGATCTGACAGACA
CGGCGTACTCAATCTGTAGGCGGCGTACAGCGCCGAACGGATCGGCCAGTTGGTGCACAAGCTGGAGGAGGCCACGGAGGAGTTCAGGGCGCTCGACATT
TTCGAGTCCATCAACATTGAGCTGGACAAGGGTGAGGACGTGTATTCAGGGTGGCTGCGGATTGACGAGCTAGATTTTGACGTGGTGGTTTGATGCGGTT
GCTGCAATCACAGCGAGCTCTGGCCAGCTCGATGAGACGGACCTGACGATCACGGTGAAGGAGAAGGGCTGGCGATCTCTGCACGTGGGCGCAACCACCG
ACGGCAACGACGAAGCAGGAGTACGGTGCATTTAATTAAAGAATCGGCGCGTAGAGATGGACTGCTAACAGATGATGCTCTTTGTTTGCAGGAATCTTCG
CTCACGTTGTCGAATGCCCTCGGTGAAGCAGAGAAGATCACGCTTAGTGCCACTTATGCGCGATCGGGCAGTAACACCCAGCGCGCGACGTTCAAGAAGC
CGCGCTTTTTTGGTCTACCGCTGTACCTGAGCGCCGTTGGCACCAACGAGCTCCACGTCAGTAAAATTGCTGTGCTACTGGATTTGTTGCAGACTATGTC
GTCTGATTTTACGGGGTATTGCTTTTTCAGAACCAAGAGTGGCTGAGCTCGTACAACGAGAAGATTCGTGCTGGTAGCATTTCGATCAGCGACTATGAAG
GTGTGCACGACCTGTCGATGAATGTGGGTTGGCGCGACCTGCTTCCGCGCCGAGACTCCAAGATTCCGACTGCGTACCGTGCGTCACCGAGTATCCTGGC
GGAAGCAATGCCGTCCACGAAGACCAGTGTGAAATATGTGTTCACGGACGACAAACGGAACAACGTTGTGTATCCGACAGCTGGAGGCCTCTTCAAGTAC
ACGTACGTGACTTGGCAACAGATCCATTGCACTTGCAGCAAAGGTTCAGCTGATCTAACAAGTTGTCTGCTTGGTGCTTCTTAGTACGGAGATTGCTGGT
CTTGTGGGCGATGTGAAGTTCGTGAAGGCTGAGGTGGAGGGTCAGAAGCACGTTGCGCTGGGCCCTGTTCTCAATGGATTCCCGATCCTTAACTTCAGCC
TTTCGTACCACTTGGGAACGGTGAAGTCGTATGGTAGTGAGCAGAACCGGCCAGCACGCATCAGTGACCGCTTTTTCCTGGGTGGCCCCATGAATGTGCG
TGGCTTCAACCACAAGGGCATTGGTCCTCGGGCTTCTCCTCTTGATGGCGGGGTTGCGCAAGGTGATGCGCTTGGTGGCGACGTGAGCTACAACGGAACT
GCAAGCCTCGGCTTCCCTGTTCCTTTGCCGCTCTTTGTTGTAAGTCTGTCTTGCATGAACCAATAACTTTGTCCGTCTAATTCACACTATCTTCGTGTGC
TTTGATGCTCAGGCGCTGGGTCTCCGCGGACAGTTTTTTGCTAACGCTGGCAATCTAACGACGTGGGACCGCCTGCTTGATGAGAAGAAGTGGCTGAAGA
ACCTTACGGACGACACGCGTGTTTCCGTGGGCATGGGTCTTGTATGGGGAACCCGCATCGGCCGCCTCGAGGCCAACTACTCGTGGATTCTCAAGGCGCA
CGCTCATGTAAGCTCTCGCTTTTCTCTCTCTGGCAATTTGATGTTGACTAATTTTCGCTACTGTCATGCAGGATAACATCAAGCGCGCCCAGCTTGGTCT
CGGCATGACCTTTTGCTAACCGTAGAGAGTAAAGGCAAAGTAAGGAGGGAGGGTTGACGAAATACACTGGCAGCATCAGCTCCCAATCCACTACATGTAG
TCGCTACCATGACGAATTATTAATAAGGGGCTAGTTACGATTGACCCCTAATTCGACTCTCTTTTAGACTGGATGATGCTCCAAGGAACCTACTGACCAG
AACCCAGGCCACTCACTGAGATCTGCCGCATCGGGAAGAGAAGGTCTCCACTTCCAGTCTCTTCATCTCTCAAGCAGCAGCGCCATGTACTCGGGCAACG
CCGCGCGCATCTACAACCCGCAGCCGGATCCGCTGGAGCGCGGGCCGCCCAAACGCGTGCTGCGCGAAGAGCAGCACATCGGCGAGATGGTGGCGGCCTC
CAAGAAGCGCGTGACGTGGCGGTTCACGCTGGGCGACTCGGACCGCACGCACGAGGTGGTGCTGGTCCACTCAGTCATGAGCTACAAGAAGGTGCGACTT
CTGTGGCTGGTTAGGCGCTACTTGAAGTGGATGACTGATGGGGAAGCGCTTTGGTGGTGCAGGTGGTGCAGTATGACGGCCGACAGATGCATTTCTCGTC
CACGGTGAGGAGATAATTTTTGATCATGTTGATGAAGTTGGGATTTGGTTTTTATCGTGATGTGTGGTGATTTGTTGTGCTGTCGTTCGTGTAGGCGACG
TTGGGCGACTGGAGCTTCTCAATGGTTTTGGACGGACTCAATGTGGTTATGGAAGTTCGTATCAACGACATGGAGTCTGCTGACGTCCCGAAATATGGTG
TGGTTGGACTTTCGCCACGTGCAAGGAGGACGAGCTAATCAGGATGTACCTGCGTGTGTTATGTGTCATGCTAGACTTCGTGATTGATCGGATCCCGTTC
CGTCGCTGGGATGTCTATCGCCGCAAGAAGCACGGGATCACTACCGCTACCTATGCCCAGCCGAACGCTCCTTCTGGAAGTACGTTACGGGCGTATATAT
TCACAGCGTTATATTTTTTTAATGATAGGCATTGTTGACGTGTGATCAATGTTGTGTGTCAATTAGATGCGTACGGAACGCGCCGGTGGGGGCCTGGCGG
AGCGACGCAAAACGAGTCTCAGTCGTCTCACGGCTCCTTCACGAGTAGCAATCGCGAATCTTTTACCGGTAGCTCTCGAGGATCCTTCACGGGTAGTTCT
CCTCCGCCGGATCGTACGCAAAGCTTTGGACAGCAGGGTGCTCGTCCGCGAACGTCTTCGGGACAGCAGAATGGACGCACTCGCAGCTTTTCGGGACAGC
AAAATGAACAGCAAGGGTTTCAGCAGTACGGTGGACAGCGCTCATCGTTGCAGGAGCAGAGTGCACCGTTTGCTCCTAACCCTGCGCCTACGAACGCGCA
CCGTCAGCCACCCCCGGCCCCGGCTGCACCAAAGCCGAAGAAGCAGCCCGAGATTAATTTGATCGACGACTTTGGCCCCAGCGTGAGCGTGTCGGCACAA
TCGTTGATTTTCGATCCTTTGGCCAGTGTAAGTGCAGTTTCACATGAGTATTCGTTTGCACAGCGATGATATATCTCACATCATAATGTTGTGAATCCTA
GGCAAAGATCTCAGCGGCTGGAGACTCTGTTGCCACAAGCGTACCCGCGCCGCACCAACAGCAACAAGCAGTCCCAGTCGCTTCTATCCCTCAGCAAACC
AACTATGTGGACCCGTTTGCTTCTGTCGCTCCACCCACACCGACGAAGCCCGCCGGAAACGTCAATTTGGATCCGTTCGCAACTCACAATACCGGCAACT
TCCAACATCAACAGCAGCAGCGCCCAACTTCTATGGGTAATATGACTCAAGCATACACGCAGCAACCTATGGGTATGGCTATGGGTGCGCCTCAGGGTGG
AGTGCTGATGCAACAATCTCACCAGCATGGAATGCGAGGTTCTTTTACAGGGCCGCAGCCCGGTGCTCCCAGTGGCATGGGCAACGTCAACTACAACATT
TCGCAACTCATGAACCCGGCAAGCCTCCAAAACGGTCAGCAGAATCAGCAGGGCAAGTCCATTAACATTGATGCGTTCGCTAGCTTGGGCCGTTAGTGCC
AAGCGGCTAACAAGCGATGCACAGACGCATATTTTGATGAAGCACCTTTGTTCCTATCGCGTAATATTCGTACGGCGTCGATGTTTACCATTGCCAAGCA
GTTCACGTGTTTCCCGATCTATCTGGCTTGTCATCTGGAGCCTCATCTGTACACGGACATACTCAACCTCAGCTTGCTTCTTGGCCTCGAGATTTTCTTT
CACCATTTCAAGGCGCTGGGCATGCTCCAGCTCGATGAGCTCGAGCTGTCGTGCGTACTGGGCTGAAAGTACCTGCACGTGGTCCTGCAATCGTTTGTCT
GCTTGTACGGTCCACTGCTTCTCCTTCAGTTTGATCTCGGCGGTGTGGAACGACTGCAGCTCGTTCGTGCGTTTTGTTAAGGTCGCCGGGGCACTCTTCG
CTAGCTTACGCGCGGCCGCGATCACCTGGTCGCACATTACCAGATGATGTTGCAATTCTTGCTTGCACGCGTCCAGTTCGGCTTGGAACTGCTCAGCCTT
GCACGCGGCGTCGTGGTGGTACAGGAAAACACTGCGCAGCTCGAGCTCCACTTTGCCGAGCAAGCGATCCAAGTTGGCTCGAAGCACGGCAAAGCCCTCG
AGCTCTTCGAAGTCCCGGAAATGCACCCGCACGCGATCCTGCGCTCGCAGGAAGAGCTGCTCCTCTACGAGCGTCAATCGCACGCTCTGTTGCACTTGCA
TCCCGCGGGCTGAATCACGCGTGACACAGTAACGATTCCCGCGACCGCCGGTTATGAACCGTTATTTCAAGTGCACATGAAAGCCGAAAATGAACGTGTG
CTTCAGGTGACAGAAATCGGCTATGGCCTCTATTGGAATAATTTACACCGCGCAGCAGGTGCGCTGCGACTTGTTCGGTGGAGCGCTGTAGTCGTCGCGC
GCCTTCTAGTTTACTGTACGCCACATCCAGTGTCGTTGGTGCTCCAACGCATGGCCGACGTGTAATTGCGCGTGGCCTTCTCGAGCGCGATGAGGTGCGG
GTCGCGGACCTGTAGAGAGCGCATGCAGTCGCAGAGCTTGAAGAGGTACTCGAAGTTGGGGCCGCTGAAGCCGCTGCGGGTGGCGATCTCCTTGGCCATC
TCATCCACAGACGACGGTCCCAGGAAGTCCGAGTTGGTGGGCGTGGCGATGTACACGAGCGCTTTACGCACCACGCCGTCCTCGCAATGGACATCGACCA
TTTGGCGGTCGTAGCCGGCCTGCTCGCGGTTGTCGAGCTTGGTGAGTGTGTCGGCAACCTCCTCGTCCGGCACCTTGTAAAGGCGGCCCCACGTGATGTG
GTCGCCCGCCAGGTGCGCGTACTCGTCGTCGAACTTCTTCATCTCCTCGCGGCTGATGAGCGTCACGACGCGGCCCTTTGCCTCGGGCGAGCCGCGGTGG
TCCGGGCTGCCCTGCCAGAAGCGGCGGTGCCAGCCTTCGACGTAGCCGAACACCGTGTCCTCCGCGGGGAACTCAGTCTTCCAGACAATCGATCCGTAGC
CAAAGACCCACATGGTTTCTAAATAGGAGCGGAGGTCTTGAAGACTAGTAGCTGCTGCTTGATGTTGCCGCGATGGAGGCGAATTCCAGAATGAGCTCGG
TGGCAAACAAACGCCCAGCCGGGTTGCCCTATCCTGGGCCAGGATTACTTGCCCTACCCACACCGTTCGGTTGTTTGAGCAAAAAGCTGCCTCAAGAAAA
TTCCGCCTTGCTGAGCCTGTGACGCGGTAAATCCCGGGAAATC