Description :
From Genome Similarity Track
Location :
Scaffold_30:354826- 366179
Transcript NameFunction/comments
Physo_134186reverse transcriptase
Physo_156870hypothetical protein
Physo_108763Autophagy-related protein 8 precursor (Autophagy-related ubiquitin-like modifier ATG8)

Sequence
11353 bases(100 bases per row)
CTGCAGTACTTCGTGCCCGGCACGAGATCAATCTCGTGCTGGATGCCCTTGTCCTGCGGAAGCTCCGCAGGGATCTCTTCCGGAAGCACGTCCGCGTGCT
CCCGTAGAATCTCGTAGAAGGGACTCGTCTTCAGCGAGTCCCAGCTGTGCTCCTCAAAGCGCTCCTTCTTAGTCTTCGCACTGAGAGTGTCCTCGCTCTC
AGTGGTGCTCTCCATGAAGAACTGCCTCAGTTCTTCATTCTCGCTCTTCGTTCTCTCGGCGTCCGAGAGAATGCATATTTGCTCGATGCGTCCATCGTGC
AAGTCACGCGCGAAGCGCTTCCAGCTCATGACTGGAAGCGAAGTCAACTCCGACGCTTGCGTCGGAGGATTAGCGAGAGTCATCTCCCTGTACCGGAACC
CGGCACAGGTACGCGTCAAGACGTTCAACGACTCGACGTCCGGCTTCTCAGCACCCGTCTGCCCGGCAGACATTTCTTGTAGCGTCTCGGCCCAAGGCCG
AGACTTGCGCAGCGACCTTCGCATGCGCCGTCTTCTTGCTTTGCGGAGCCCGGCTCCGCTTAATTCTTGATCCCGTCCAGGCCCAGCCGTGGACGGGTGT
TCTTCTTGTATACCACCGGCGGGTATATCCCGCGGGCGAGCGACTTCAAGCCCGGCTTGGTCGCCTGGCGCTTCGTCGTGCAGCCCGGATGCACGACAGC
ATGCAAGTTTTTCCGGTGTGGGACGTTTGCAACCGTCCGCACCGCTTGTAGCGTCGGCTCCCGGAGCCGACACGCCATCTTCACCTCGACGCCTGTTATT
GGCGGAGCCCTTCGTTGCAAAGGGTGCGTCGACTCCCGAAGTCGACGCGAAATTCCTTTTCGCAGCGCCGGTTCCCGGAACCTTCAATACCTCGACGCCA
ACCATTGGCGGAGACCCCCATTACGGAGGGTGCGTCGGCTCCCCGAGCCGACGAATCGAATTCACCCGATCCATCGACTCCCAGAGTCGACGGCGTTTCG
TCACCTTGGCTCTTATTATTGGCCAAAACTGATCCAATCAGATTCGCGTCAGCCTCCACGGCTCAGGCGTGTGACTCGCCTGCGTCATCCGTGCCCCTTG
AGGTCGGAGACTCTTCCTGATTCGCTGAAAAGCGGGTGTCGATCTCCGAGATCAACCCATTTTCTCCTTCAGCCGTCGGCGGCGACGCCGACGCTTGCTG
CTCTTGCGCGCGCCCAGGGCGCGCGGAACTGCATTACCAGTAGGGCGCCCCGCGCCTACTGGCGTCCAGCGTTTTTTGTTTGGTTGCGACGGTGCCCGGC
ACCGCCGCGATAGCTACCCTGCTGGTGCACGGGGGCCGTGCACTCCGGAGCAAAGTGACCGATTCTACCGCATCGGTAGCATCGCACATTGTTTCCTTGC
GACTGCTGGGGTCCAGCAGTTGCAGCGCTCGAGAAGTCCATGGGTTCTGGGCCTCCCGTCCTCACTATCGGGCGAGGCTGTGGCCTCGGCGCATGTGCAT
GCAGCTTAGCCTGCCGCAGGCTAAACTCCTCCTGCATTACAAGAGTGATTGCAGCTTCGAGAGTACTCGGGTACTCACGGAAGAGATAGGTCTTCACAGG
CCCATCTCTCAGTCCCTTCATGAACGTGACGACCTTGGTCGCCTCGTCGATCGGATTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTCTGAGCGTAA
GCATGGACATCATGCTTGCCCTGCTGCAGGTCGAGGAACTCCGCCCTCGACCGGAACTCGTTTTGCGGGGGCTCAAACGCTTGTCTGAGCTCTTCCTTGA
ATCGCTCGTACGTGCTAAAGCACGTAGGATCCGAGAGTCGGCGTCCATACGCCCAACTTCTTGCACGTCCGCCAAGACATGACATGGCGAACGCGACCTT
CGACAACGGGTCGACGATGCGTCGAGCCGCAATGGCAGTGTCGAGTTCGACAAGCCAACGGAGGAGAGGCTCGCCCTCTCTTCCAACGTAATTGCTCACG
CTGAGCTTCAGCGATTGCGCGCGCGGTGTCGTCCCCAACGACACCGTGGCAGACGAAGCAGCATCTCGCTGCTCCCTCATGATGAACCCCAGAGCAACAC
CATGTTGCTCTTTCGGCGATAGCGATCGCAGCATCGCAGCTACTGCCGCCTCCCCAATGACTGTTGACAGTCGTTGGGGTGCCTCCCACTCTGGATCCGA
CAGGTGGAGGCAGTCAGCGCGTGAAACATGAGTTGCAGGCGAAGTGGAGCTTTCCATGGACACCTCCGCGCTCATGAAAAGATTCTCGGCTCCTCGTTCG
TACAGCTCCGTACGAACGTTCAGGTAGTGCTACCAGATGTAGTGGGCCTACCTTGGCTCACTACTACGGCTTACTCGTATGCGCACGTGTATGAGGAAGC
GTAGATTTCTTTTACTTGGTTAAGTATACTCGAGATCCATGAGTATACTTTAAACAAGATAAAGACTCCAAATAGCGGGGTTTGGTAAAAGATGAGAACT
GCTATTTTTGTTTTATGTTTCTGAATGTGTATGGACCACCCGTCGTGGTGGTCGTAAATGTATGTAGCCATTGGTGTACCTTACATCAAGGTCGAGGAAG
TGTTCAAACCTCTAACAGACATCGCATCTGTTAGAGGTACAAGTGACTGTAGCCACTTGTGCGTGTAACCCCGTTACAGAAAAGGCCGAGACAATGGAGG
CCATATTCGACTACTTCAAGAAGAGGAATGGGAAATGGAGTGATGTCCAGTCCTTTGTCATTGACGAGCACTTCACTGAGTGGAAAGTGTTGAACAAGTG
TTTTCCGTCCGCCTGGGTGTTGCTATGCCAGTTTCACGCAATCGCGTTCTGGAAAAAGCTACTCCGAAAGCGCTGCTTTCGCCTCAGCACGTCGGAGAAA
GACCAGATTCAAAAGTTCTTCGCTGACATGCTGTACAGGTATGTAAATCTTAGTCTTTTATTCACTTTAGGTGCTAGTCAATCACTGACCCGTGTATGAA
TAAGCTCGACGGGAGTCCGTTTTGAGCAGATATACTCCAAGTTTGCTACTTGCTGTGAGACAGGTCATAGAGAGGATGTCAAAAACTATTTTGATAAAAA
CTGGAAGACGTGTTTGCCGATGTGGGCAAACTTTGAGCGCAGCAAGTGTTTCAGCGCTGGAAATACGACAACTAATCGAATTGAGTCGAATTGGAACCAG
CTCAAGATGGTTCTCGGAAAGCGGACAAGTATTGACAAGTATGTTTCCGCACTTCTGCAGCACCAAGCGCATGTGCTCAGCCAGATAGCTCATGGATTTG
CATGCAGCGCTAGAAGTTCGCACTCACCTGCCGGTGTGCCTCTCATTTTACGGAAAGTATCTGGCGTTATGAGCGATTTTGTGTGCGTCGGCGGTGGGAT
ATCTTTATGATCCATGGCGCCGACATGAATTTGGCTCCGGTTCCAAGCTCTTGTGATTGGGAAGTGCATTCGAACGGACGTCGTTTTATCTGTAACGATA
ACCTGTGGTCCTGTTCGTGTTGGTTTTATACAAGCCACCATCTTTCCTGCGAGTACATTATGGTTGTCGCTATAAAGGAAAGGGGTATAGTGAACTACCA
GTGGGGGCATTGGCAACAAGGTGGAACATGGAGCACGCACTTGGATTGCATGATGAGATCGACAAGAACGCGTCCGCTACAGATGACGCTGTGGACGTGT
TAATGATGAGCAAACCCTGTAAGATGAAGGCGCCGGTAGATGATGGGAGCGGAAGTTCAACGAGCGAGTCTACCGATGTTCCACAACCGATTTCGGTGAA
AGGTGATTCAACAATACACAACATGCGATCCGATCACCGTGGTGAGAGCCCACAGAAGGTTAAGAACGTCACGATTGTCCATCTACAGCGCGAGCAGCGC
GGAAATTTGGCAATTTTGTCATCACGCGAGAAGTATAATTTCGCTGTATCCTGTTTCCAGCCTGTGATTACGTACCTACAGAATTAGGGAGTAAGAAATT
CTACCCTGCACTTGATTTTTAGCAGAAGGTCTAAGTGAAGATGCAGAAAGACCTACAGATTTAGATGATGGACACGACGAAACAAGTGATACTCTAAGTA
TGATTGATCCAGTCGACCTTGCCGCGATTATACACGATGTAGCTACATGGGAACAACCAAGTCATGCTGCCAGTAGTGAAGAACCCGATCCAAGTGTTCT
AATGGAGGAGTTATTTGGGATACAACCCAGCTCGCTGGTGCATTTTCCAAGGCCATTTGATCCGAGTGAGACCGACATGACGGAGTCCTCATCACCCTTA
CAAGCCGTATCCAGGCATGTGGAGGTTCCCTCGACCGAAGGTGCTAGCAGATCGGTTTCGACAACTCGTATTGGGAGTCTGCAACTCAGTGAAAAAGAAA
GATGCCAGCCTCAAAATGAAAGCGAGAAACACATACGGCGCGGGGGTATCAATGCTATGAATCTTCCTAACCCTGTGGTCCAAGGGAACCCCAAGCGAGA
GAAAGTATTGTATTGGGCTAGCAAATCTTCAAACAGAAGATATGTGGATGGTTCCCCTCCCGACGAAAGTGCTCCTCCAAATATTGCTGAGCTTGTGCAT
TGGGCCAAACACACAAACTCCTTACAAAAAGTGGATGAAATGATAGACCGCTATCCAGTAACGATGAGGAAACGAGCGCTTAAAGGTCGGGCGCCTATCG
TTGAGGCCACCTCCAGCGCCGTTGCCCGAGGATGCTGTCATGCATTTGACATCCCGGAAGGTCTAGTAAAATCCATATCGGCAGCTCTTCTAGCCGACAG
ATCTGCTATGATCCGAAAGTCTGAAACGCAAGGAACCAACCCATCCAAGTCGAAACATGAGATAATTGACGTCGACTCAAGCCCGACCGACGTGCAAGAG
AAAATTGTGAAACTCAAGGCATCAGGGCCTAGCTTTTCCAGGTATGTATTTTCGAATGCTGCGTTGGTGGAATGTGATCAGTACTAATACGTGCGATATA
TGTGTTATCTTTGCAGCAACTGTGTCGATGCTATTAGAAGCTTTTACAACTGCAGAAAGCAAATTACGTTATGGGAAGTGGACTTAACGTGGCAGAAGAA
AGACTGGTCGAAAAACAGCGCTGTTGATGTGGAATTTTTTGCGTTCGAAGTCAGCGCCCGTGAGCTACCCAGAGAGAAAGTCAAAGCGCTGCATGTTCGA
CTGGCGGATGGCGGGAATGCTGGCTTTGAATCCGCTTGCTTACAATCGTACTACTCAGTTCCATCGACGAAAGTGACGATTTTCTTCTGGGAAATCGTTG
GATATATTACCGGGACCGTGTGGCTGAATGATTCGGCTGTTAATTGCGGACTTCAGGCTATGGCGGGCTGTCGGCCCGACGTTCGAATTCTACCGTCGCA
CGTGTTGAAAAAATGGCTTCCCCAAACGAAAGCAGACACAAAAAATGTCTGACATGACTATTATGATCCTCCCCATCAACAACAAGGGCATTCATTGGAC
ACTCATAATGGTCACCGTCAACTACACAAATTCAAGGAAGCTGGACGTCCATTTTTACGACCCGTATCCCGGACGGCCTTACCAGACAGAAATCTAATCG
GCATGGGAGAAACAGTTCTGGCCGTTCATGCAGCGCTGGCACAAGGATACGGTTGGTGGTCATAACCCGACTATTGACAAGCATTGGATAAACAAGCCCA
CCCAGCCCGATGGATCGAGCTGGGGTTATGATTACAGCGGCTGCATATTCCTACGTGCAAGGACAACGCAAATTTGAGTTCGAAAAGATTTCTAACGAAG
CGGTGGAGGTAATGCGACTACGAATACTGTGGATGATTTTGTGCAACTACTGTGGGCACAATTGACAAGGGAGATAGTGCTGCTGCAACTAGAACGGATG
CGAAGCTAGCGCTTGCATTTCTGAAAGAGGAGCGAAACGAATGACCTTCAATCTACGTATACGTTTACTCGAGTACTATTTTTTGTGCTCATAATTTCGA
TTTTCTGATGTAGTAGGGGTTCTCACGGTTGGTAGGTTTGCAGGTTGCAGGTAAAACTGACCACAGTCAGATTCTTCGTGCATAAATTTTCCTTTTACGA
GCGTCAGTTAGTGGATCGAGGCTAGCTGTAGGCGGGACCGACACGAGCAAAGCCGGTCTGGCCGCCAAATGTTCTGCTCGTGTGTTACAATTTTGTGTAC
GACAGTCGCCCCGGACGTCAAAATATTTCCCTCTGCACTAGATCGACGAGAGTGGGCATGCGGCCAAACATCCCTGGAAGCGGAAAGATTGCCACACGCC
TCTAAATTTCTTCTAGTGGGAGGCAGTAGTCAGCATTAGTAAATGTGGCCGATCTGAGTTACTAATAACTGCAGTAGTATGAGTTGGCTCCTCGTCCCAA
AATAATAGCAACTGTAGTATTTAGAGCATCATTTTAATAGTGGTATCAGTGGAATAGTACTGTAGTTCAAAAAAATTACTTTCAATTCCTGGTCACAACC
TTACCCATTTTTGGTACTCATATAAATTATAAGAGATGTACCATCCTTATGGTACCGAATAAAAAAATTTAAGAAGCCTCAGCCGCCTTTCAAAGTACCG
TCCAATTTGGATGCGATGGCGCACCCCCCGGTTAAGAAGCAGGAGTTCCTGGGCGCCGTGACGCTGGTGTCCTTCTCGTGCGATGGGTCTCTACTTTACG
TGGGTGTGGGGCCTACGATTTTCCTGTACGCCACTGCTACGGGCGAGCTCCTGGGAGAGCACAGCGTGTTGACGCGAGGCATTCTGCACGGCTGCGACGT
CGTCGGACTTCATGGGCCCAGCAGCACTGACACCGGGACGTTTGTGGGCGCATTCTTTGGGCAAAAGCGAGTGGCGTGTTTCAAGGACCTTCCGCAAAAT
CCGGAGGCTGCGCAAGCGCTTGGAGGGCTGACGGTGCTCGGGAAACCGAAAGTGTTCTGCGACTGGGTGTTCGACGTGCAGCTGCTGACAGACGACTTCG
CGTCTGAAGAGGAGGAGGAGAACAAGAAGCTGCTGGTGGCAGTGGGCCTTGCGCACAACTTGGTGCAGATCTGGGACCCGGTGCGCAACAATATTCTGCG
CAGCGTGCAGTGCGCTGAGCGCTGCATTTTGTACGCGTTGTCATTCCACGGACGATCACTGGACAAGCTCGTGGTGGCCTCGGGAACGGTCTTTCAGCAA
ATATTGATCTGGAATCCTATGCAAAATGCTGGCGACGACACGGATCCTGCGGTGGAGCCGGCGCAACGACTTCATGCTCACGATGGCGTCCTGTTCAAGC
TGGCATGGTCGTCGGATGCTCGCGCTCTCACTTCCGTCTCTGACGATCGTACAGTACAGCTATGGTCGAACATTGGGCAACCTACAGTCGAGCAATTGCT
AGGAGCACGAACAGCAAGCCGGTCGGAGTTGCTTGCAAAGGAGTACTCGCCAGTGTTCCGGTCCTGGGGCCACTCGGCGCGGATTTGGGACGTTGCTTTT
TGGAAGCACGGCGTAGTGACGGCAAGTGAGGATGGCCTGTGCAAACTGTGGGGTCTCGATGGCAAATGCGTAGCTACATTTCAAGGACACATGGGCAGGC
ATGTGTGGCGTGCAGCAGTCCACCCGTCTCAAAAGATCATTGCGACTGGAGGTGGTGATGGTGCTGCGAAACTCTGGGATATCAAGCGCCAGCTCATGTC
CACCACCGATGCGCCCGAAGCTAGCGAATGGAGTAAAACTATCCGCGTCCCATTCGTTGCGCCAACGACTGTGTCGAAAAAGAAGAAGGGGGGTCAATCC
CACAGCGTGCGCAACATCGTGATCAGTTCTCGAGAGGAAGGCAAAACTGCATTTGTCGCCTCTGAGCACGGAGAGATCTATCGTTTGGACCTGCCTTCGC
TCGCGGCGGAACTTTTCTTCACAATTCCTCCATTTGACGATGCCCCGGCGCAAACAAGAACCGGAGGTCTCTCGACATTTGCAATCGACAGTTCTGGGCG
ATTTTTGCTGCTTGGTGACGTATCGGGTCGTGTATGTGTTGTCGAGGCATCTACCGGCACTTTGCTGCACTCGTGGACCGCACATGCCAACATCCGGATC
ATGAAGATGTGGTGGGATCAGGATGACACCCTTTTCATTAGCAGTGCTAGTGGCATTCTTTCCGAGTGGAAGCCATCTATTGCCGAGCAGACCGACAGCT
CGATATCACCGTTTATTTCGATGGAACTGGTCGCGTTGTTCAAGATCCCCGCCAAGAGCTCGGTCTCATCGATCCTGGTGGTAGATCGCTCTGCGACGAG
GAATATCATCGGAGGCGATGGACATGGCAGTGTGTATATCTTCCAACGCCCGCTAGGTGCCAGCCAAAGTGGCGATAACATCTCCGATGTGCGAAGCGCA
GGCGTCGTGCGCAAGGGTGTTCACGGCCGCGAATTGGTGGCATCTCTTCTACTTTCTGAAGAAGTAGACAGTTCCCAAGCCCAACACGCTGTCATGTTTT
CGGGAGGTCACGACGGGTATATTTGCTCGTTTGCGCTTGAAGAAGATGTGAGTGGAGCGCTGACGGCTACACAGGTTGGCCGCGAATCCATCCGAGGCAT
CTCCACAGTCAAGCAACTTTGGTGGAACTCACCGTCTTCCGAGGGCAACACGAAGAGGGATCTCATGGTGTTCGGCTTCCACGCGGCGCAAGCTGTTCTG
CACAATTTCTCAGCTCAGTATCGAGTCTTCAATGTCGAGTGTGGAGGATGGCGTCGCCCACACACTCTTTTCACTAGTGCTCATGGCAAGGGCTCGTGCG
TGCCCTCGCACACGTTCGTTTTCACACCTCCTTCAACTCAGAAGCAGCATGTAGATATCAAGGTGCATTCGACCCTTTTGGGGAATGCAACTTTATCGGA
GACGCCCGCGCTATTTTCCAGGTGCTCACTGCATGACCAGCATCATGGCCGGATGACGACTTGTGTGGCATTCCTTGGTAATGACCGACTCGTTACTGCA
GCAGAGGACAATAGTCTGATGCTACACCGTCGTCGCTTTCGACGTGACCACAATAGCTGGCGTTGGGGAAGCGTGGCCACTGGGATCGCACATACGACTA
CGGTGCGAGCTCTCACAACATTCCAGCGTAAAACTGATGACGGTGTCGTGGATCATATTGTGCTATCGGGAGGTGGAAAGCAGCGTTTAAATGTGTGGCT
AGTTTGTGGAGAAAGCGATTTGCTCCGGCATCTCTGCGGCCAGGAGCGCGCGGATGCAGAGCAGGACCACCGCATTCTTGGGTTGGCAACTTTTGCGATA
CCCTCTGTGTCGGACGCGTATCGACTTGTGACTGCGTGCAACTCCGAGGGGTCTACCCAGCTCCTGCTACTTGACGTGAATCATGGCAAGCTGTACGAGC
TTGGTGACTGCCGTTCAACTTCAAGAAAGCCGATTCTGTCCTGCGTTGGATTTGAGGAAGGCGGAATTGCTGGATTGGCAGTAGGATCAACGGATGGCTT
AGTGACGCTGTGGGACCTGAGCATGCTGCTGAAGGAGCTTGCGTCCCTTCTCCAATCACAGGAGGACAAGAACCTTTTCAATGCGAAACTTCTCGGACTG
ATCAGCACCATGCAGCCAAGTGGGAACTACTTGGCCCATGACATGGGCGCGAACTGCATCAACCTTGCCAAGTGCGCGAAGAGTGAGGAGGAAGGTAGCC
TCGACGTTACTCTTATTAGCGGCGGAGACGACCAGAACTTGCTGCTGCGCGAATTGCGCTTCCCAGCGTGCCAGAAGTTATCGGAGACTCGGGCAGTAAA
TGCCAGCGGATCGGCTATCAAAACCGTTGCGTGCGTGGATGCACAGGTTGTTTTCGCTGCTGGTTATGATCAACGAGTGAGCAAGTGGATCATACGCCGC
GACGGTAACGAAATTCAACTGGAATGGCGAGGTGCAGCCTTCTCCGAGTGCGCCGATGTAGCAGATCTCGCCATTCGCCAAGCTTCAACTGCAGAGGCTG
ATGAAGTCGTGGTCGTTGGCCAAGGTCTGCAAATGATGAGCTTCCAACGCGAGTGAAAGCGTTAGCACAAAAGATAGACTGGTGCGAGCGAGTGAATAGA
ATTGTATGCATTTTTCTGTTTATTTTTGCTAAGAAAATATCCACATCGCCAGCTTTAGAAGAATGGACCACACGCAGCAGCAAATACTTCTTGTCGCGCT
TCGAGTAGCCTGAGGCAATCAAGCTTCCCTCCTTTACCCGCTTCAGTTTGCCATCACCCTCGTGCAAAAGACGCTTGGACATCCGATGCTGAATGACGGT
ACCGCGACTCCCAGCTTAAGAGCGCAGAACCCACCGTCCACTACAGCGACGACGAAAAAAATCTTCAACCAAAATCCAGTCCCCACACGCCGACAGCGCC
TATTGACCGAAGGTGTTTTCGCCGCTGTAGGTGATGTAGAGGAAACCATCCACGTCTTTCTGTTCTTCGTAAATGTTCGACATCAGTGCCGCTAAAGCAG
AAAAACCGCAGTAATATACATCAATTAGTACAGAGACAGCAACAAGGTAGCACGGTATGGTCACATACCGGTGGGTGGGAGGACGTTGTTGATGAAGATG
AAGATCGCCTTCTCTGGACTCAGTTTGATGCGCTTTCGGATCACATACACGAACTGGCCGACTGTCAGATCGGCCGGCACCAGGTACTTCTTCTTGTCAA
TGTCCGGGATGTCGCTACGGTCCGCCTTCTCGCAGATGACCTGCACCACAATGGAGAAACTCGCCAGTTAGTTCTCGATTAGCCAACACGAAAACACCTA
TAGCGTACGCACCGGAATCCGGTCCGGGTACTTGGATCGGATGCGCTGGGCCTCGGCTTGGCGCTTCTCTGCAAAAATGGCACCATCAAACGTCGTTAAC
CTAAATCTGAGACCGTGGAATCTTGTGGACCTGCTCAGAGAGCTACGCACCGAACGGGTGCTCCTTCTTGAATGAGCTCATCGTTGCAACGTGAAAGACT
GGTGGCGTCTTCTGCTCCTGCTCCTGCTAGTGCTTCTCCGAGATAGTTACGTCTGCAGCAAGCCACACAGCAACACAGCAGCGTCTCCGGTCAGTCTCTT
TCTCGCTCGGGACCTGGTACCTCCCTTCGAAGGGTCGCTTCACACTATCAGCACTCCGAGTTCGCGCGCTGCACCCGCTAAAGCCACTGAATCCGCAGAC
GGCTGCGGGCGCGAACCGATTTCGGGTTGAGTCAGCGCAGCGTGCGCCCTCTCGCCCCGTGCAGCGCGACTCGAGTGGCACGCGAAGCCGCTGCTCAACC
GCCACATGCATCGTAATCCTAATGTATGCAGGGCGGGGCCACGCCTCGATCTG