Description :
From Genome Similarity Track
Location :
scaffold_275:35481- 37651
Transcript NameFunction/comments
g6676.t1 hypothetical protein PHYSODRAFT_544632
g6677.t1 hypothetical protein PHYSODRAFT_462492

Sequence
2170 bases(100 bases per row)
TTCCTGCTCCGGTCGAAGCGGTGTCGGACTGTGTGCGTCGCGCTTCGAGCCACTGGTACAGCCACTCGTACGTGGTCAAACCTCGGAACGCAATGTAGAG
GTGGAAGGTGCCGAGTACCAGCAGGAAGAAGAGCTCAAGCACTGGCAGGACCGAGAGGACGCACAGCATCACAGCTCGAGTCTTCTTGCCATCGTCTTGT
CCGGGTGCTAGCAAGCACGAAATGGCGTAACCCGTAACGATCTGCTGAGTGAGCAGCAGCAGCGTAGAGCACGACAGGAGCCCCACGAACAACGGGTAGT
TGCGCGTCCCAATGCACGTGTTGAGGTAGATGCAGTGGTGGTCGTAGCCAGGGACGCACTTATTGCATCGGCCGCAATGCCTCGTGTCGGACGTGAGAGC
GAGGCGTCCACAGTCTCGACACGTTGCCACGACCGGATGCGACGTCAAGAGTTCTGGACTCGCTTTCACGTCGGACGCGGCGCTAAGCACAACAGGCGGC
ACAGCAATTGCCTCCTGGTCTTGAGGCTGCGTCGCCTGCCGTCTCGGTTGTCCCGGGTCGAAGCGCGAGATCTACAAAAGCAGCAGTAGGCAGGAACAAG
CATTCAGTACAGGAGTAGCAGTAAAAGCAGCTTTGCAGGCTTCGTACAATGGCGAACAGCAGGGTGGTAATGGCGAACTGCACGCTGTAGAGCGGCACCA
CGGCCGAATACACGAGAACAGGCAGCTCCTGCACGCTGAAGCCGTAGAAAACCACCGCCGAGAGCAGTTCAATGGTCACCACCTGCACGTAGTACGCACG
TAATCCCAAGCTGAGACCTCTTCCATTCGTTTTTGGCTCCTGCACGGACGCACCGCAATCTGCGACGGGTGCAGCGGAGCTTCACAGCCGTGACGACGAG
CAGCCCCCGACGCCATTCCGGTCCGCTTCAATCGAGAAGTCGTACTTAACAGCGGCCGGAACGACTGGAAAATGAAGACGGACGCCGAGCGATCCCCGAC
CAGCGGCGACATGCTCCAGTGCGCGGCCAAGACGACGCTCTCGCGCGCCAACGCGCTCTTCAGCAGGACGCAGACGCCGTGTTACCTGCCCACGAGCATC
GCCGGCAACGTACCGCACTTGACGCCTGACAATTGCAGCAAAGTGCAGGACCTGACGGCGCAGGTGGTGGACTACGCCGACATGTACGTCTGCTACTGGG
AGCCTCTTTGGCTCGGATACGTCGTGTTAACTACAGTATATGTAGCTCGAGTTTGGTGCAGTTGGCGACGGACACGAAGCGGCCTTTTCGAGATCTTCTG
AACGTGAACGACTACGAGCTGGTGCTGTCGGCTAGAGACTACATCAGCGAGTCTGTACGTGAGACTGCGCGTATAAACTGAGGGTGCAAGACAACTGACT
GTGTCTTTCGTAGAACCCACCGAGCTCCAAGGCCACAGGATTCATGATCGAGACGAGCGGAGGCCGACGCGCCGTGTCCGCTGACGAATTCATGCGGGCG
ACGGCGCTACTGCAGCCGGAGCTGGTGGTGCCGCTCGCGGATGAAATCCCCATCAAGAAGGGCCGAAACCGGCACCGCGCTGCTGTGCAGACGTCGCTGG
ACTGGCTGGATGCGTGTCAGGCTCTCAATACTTCGCGTACGCCCATGTGCGGCGTAGTGGTTGGCGGAAACGACCAGACGTTGCGGCGGATGAGCGCTGG
CGAGACGTGCAAGCGCGACATCCAGGCGGTCCTTCTAAGCGGATTACGACAGTGCACGGACAGATCGAAGCGGCTGGAGCTGATCGACGCCGTCGTGAGC
GAGATCACTCCAGCGTCGCTTCCCCGAGTCATCACTGGGATCGGCCACCCACTGGACGTACTAGACACCGTCAATCGAGGCATCGACGCCTTCGTGTCGC
CCTACCCGGCTACAGTCACTAAGGCGGGCTCTGCGTTGATCTTCTGGATCAGCGACGAGGAAGACGGGGGCAGTGGCAGTGAGCGCAACGCAGAACGAGA
ACGCTCCGGTGGGGTGCTGCACCTGCGTGAGAAGAGGTTCGCAACAGACTTCGGGCCGTTGATGGCGGGCTGCGACTGCTTCGCGTGCCAGAAGTACACT
CGAGCGTACATCCACCACCTGCTGAACGTCCGTGAGATGCTGGGCGACATCCTGCTGTACCTGCACAACT