Description :
From Genome Similarity Track
Location :
contig_21:354768- 357184
Transcript NameFunction/comments
g4831.t1hypothetical protein

Sequence
2416 bases(100 bases per row)
CTCATGACTGGCAGGTCACGCAGATCGCGACGTCCCGTTGAGTTCTCTGCTGTGATCTTCCAGTCCTCCGCCGGCAGGCAGCGCATCACCTCGTCACTAA
ACTGGTCGCACGGAATGTCGTGCTCGATCAGCAGCACGTTGGTCTCCGTTTCCTTGTCCCCAATGACACCCAGCGTGCGAACGTAGTGACCCAGAGGGAA
CTTGCTGTCCGCTGGCCACGAATCAATTGCCACAAGAATTCGCTTGTCCATAAGCGTCTCCTGCTGGCGCGTCTGGATCTTGATCTTCGGAACCTTCCTG
TCCACAGGCACCACGAGGCAACTGCCAGAAGCATTGAAGGTCGCCGTCGCGCGGAGCCTCAAGAGACCCGCAAAACTTACGCCAGTTGCGCTGAATAATG
CCCACAACGCGGCCAGCAGGCTTCGCGTGTTGAGACGCATCGCTCTGGACAAGCGCCACCTGCTCCAGCGAGACCGTGGGTTCCGCCACTCCGACAGGTT
CGGGCTGCGCAACGTCTTCCTTGTCATCGTCAGCCACCTCGGCAGCCTCCGCTGCAGCCGTTCCATTCGCTGCAAACGAGTCGGACGGCTTCTTCCACTG
CTCCTTTGGCAGCAGCTGAATCGCCACCAGATCGCCATCAATCGCGCGGTTAATATGCTCGCGGCCTTGCAGTAGCACGGGGATCTTGACGCCATTCGCG
CCGTGAATCAGCACATGACACTCCAGCCAGTGGTCTCTGTTGCAGCGAATCGTGCCCTTAAAGTACCGCTTGTTCTTGATACCTGCCAGCAGCTCCGCGG
CTGACATATGCTCCGGGTACAGCTTCTTCTTGCTGTGACGCCCAGCCGAGCTGCTCACACCTTCTGCCGTGATTTCCTTCTCCTCTGCGGCTGATGCTGA
CAGCAAATCCTGCAGCTCTGGGAACTGGGCCGCCACAGGCTTCACAAAGTCTGCAATGGTCTTCCCACCTACGACACCAAACTTCTCGGCGTGCTGCAAG
TCCTCGGCGTCGTTAGCCAGGAACAGAACCTTGACGTCCTGGCGCTGCAGCTGCTTCAGGTGCTCGGCGTACCATCTCCAGGCGGTGGCCACGGCGCGTT
CGTTGCGCTCGTCCTCCGTCTCGATGGACACTTGGTCCTCCAAACTGTCCTCCTGATATCCTCTGGGCAATAACTGTTTCTTCTGCACGTAACATGCACG
ATGGTGCTCATTGGCGAACACCACAAAGCGCCGGTCCACATTCATGAGCAATGCGCGCAGCCGGTTGTACACTCCCAGGTCCTGCCGCTTCACAAACTCC
CAGACCGTTTCGAGCACGAGGACATCAGCAAACACTTGGTGTCCGCTAGTGTCCACCTTGGTTTTTTTCTTGGTCGAGAACTCCAAAACGTCCATCTGCA
GCAGGAACGTCTTCATAGACGGCAATAGATACACCCCGTCGCGCGGTGTGTCCGCCAGCACCGTCTTGGTCGTCCCCAGCACGTGCGTCGCAGCCGACGC
GTCATCCTCGGCGCTGCACAGCGCGCAATTGGGCAGCGAGCAGCTCAGGTCGTCCCGTAGGTACCTCTCGCGAACTTTACGTACGATACGGCCGCGCCTC
GTAGCCACGTTGAGCTCATCCAAGCACCAAGTCGGCGGTGTATCAACGGCCTCCATTGCGAATGAGCTAATGGCGGGTGGCTGGCAGAATGAAAGGATTT
CAACCAATAAAGCGTGGATAAAAAATATACAGCCAATGGAACGGCATTTGAGATATGGGTACATTGCTCATAAATTAACACCATGGTCAGGAGTGCAGGA
AGTGGTGGAAGACTTGCAGCAGTGGTCGAATCCGACTCGCTTCGACTCGACATCAGACCGATGCGACTTCAGAGGAGGAGCTGGAAACGTGGCGAGGGAT
GCAGTCAATCAAAATACGCGAAACTACACACTGTTCGTGAGTAGAACAAGCGACATATCGGTTAACGACGACAAGGTCGCTTCTCGTCGAAGTTGAGCCA
TTTGAGGCCACACAAAGCTCCTCTGTTGAAAGCTGCCGTAAGTACCTATCCTGCGTTTTATCCGACTGTATACGTTAGCTGCTTGCTCATTCTGATGGTA
ACCACAGCATGACAGAGCACCTTCCGGCCTGCTTACTGACTTCACTGTCGTGGTGATAGGCCACTTCGTCGCCTCTTAGCTCGTCTTGCACTCCACGCAG
TAGCTAATCGGCTCTATATATGTAAGCTGTTTTTCCAGATCTGTTTCCGAGTGACTCATGACTCTGCTGCTTGTGCGAACCCACCTGATGGCCAGATATC
ACCGCCGAGACTCACGAAAATGGTCAGCTCGCGTAGGCATCTTGATTATCTCTCTTGGGGTCTTAAAACGTTTGCGCTGGTCCATCGCGCGCACTTGAAT
CAACTCGGTGCCAGGT