Description :
From Genome Similarity Track
Location :
contig_21:354732- 357148
Transcript NameFunction/comments
g4600.t1hypothetical protein

Sequence
2416 bases(100 bases per row)
CATGACTGGCAGGTCACGCAGATCGCGACGTCCCGTTGAGTTCTCTGCTGTGATCTTCCAGTCCTCCGCCGGCAGGCAGCGCATCACCTCGTCACTAAAC
TGGTCGCACGGAATGTCGTGCTCGATCAGCAGCACGTTGGTCTCCGTTTCCTTGTCCCCAATGACACCCAGCGTGCGAACGTAGTGACCCAGAGGGAACT
TGCTGTCCGCTGGCCACGAATCAATTGCCACAAGAATTCGCTTGTCCATAAGCGTCTCCTGCTGGCGCGTCTGGATCTTGATCTTCGGAACCTTCCTGTC
CACAGGCACCACGAGGCAACTGCCAGAAGCATTGAAGGTCGCCGTCGCGCGGAGCCTCAAGAGACCCGCAAAACTTACGCCAGTTGCGCTGAATGATGCC
CACAACGCGGCCAGCAGGCTTCGCGTGTTGAGACGCATCGCTCTGGACAAGCGCCACCTGCTCCAGCGAGACCGTGGGTTCCGCCACTCCGACAGGTTCG
GGCTGCGCAACGTCTTCCTTGTCATCGTCAGCCACCTCGGCAGCCTCCGCTGCAGCCGTTCCATTCGCTGCAAACGAGTCGGACGGCTTCTTCCACTGCT
CCTTTGGCAGCAGCTGAATCGCCACCAGATCGCCATCAATCGCGCGGTTAATATGCTCGCGGCCTTGCAGTAGCACGGGGATCTTGACGCCATTCGCGCC
GTGAATCAGCACATGACACTCCAGCCAGTGGTCTCTGTTGCAGCGAATCGTGCCCTTAAAGTACCGCTTGTTCTTGATACCTGCCAGCAGCTCCGCAGCT
GACATATGCTCCGGGTACAGCTTCTTCTTGCTGTGACGCCCAGCCGAGCTGCTCACACCTTCTGCCGTGATTTCCTTCTCCTCTGCGGCTGATGCTGACA
GCAAATCCTGCAGCTCTGGGAACTGGGCCGCCACAGGCTTCACAAAGTCTGCAATGGTCTTCCCACCTACGACACCAAACTTCTCGGCGTGCTGCAAGTC
CTCGGCGTCGTTAGCCAGGAACAGAACCTTGACGTCCTGGCGCTGCAGCTGCTTCAGGTGCTCGGCGTACCATCTCCAGGCGGTGGCCACGGCGCGTTCG
TTGCGCTCGTCCTCCGTCTCGATGGACACTTGGTCCTCCAAACTGTCCTCCTGATATCCTCTGGGCAATAACTGTTTCTTCTGCACGTAACATGCACGAT
GGTGCTCATTGGCGAACACCACAAAGCGCCGGTCCACATTCATGAGCAATGCGCGCAGCCGGTTGTACACTCCCAGGTCCTGCCGCTTCACAAACTCCCA
GACCGTTTCGAGCACGAGGACATCAGCAAACACTTGGTGTCCGCTAGTGTCCACCTTGGTTTTTTTCTTGGTCGAGAACTCCAAAACGTCCATCTGCAGC
AGGAACGTCTTCATAGACGGCAATAGATACACCCCGTCGCGCGGTGTGTCCGCCAGCACCGTCTTGGTCGTCCCCAGCACGTGCGTCGCAGCCGACGCGT
CATCCTCGGCGCTGCACAGCGCGCAATTGGGCAGCGAGCAGCTCAGGTCGTCCCGTAGGTACCTCTCGCGCACTTTACGTACGATACGGCCGCGCCTCGT
AGCCACGTTGAGCTCATCCAAGCACCAAGTCGGCGGTGTATCAACGGCCTCCATTGCGAATGAGCTAATGGCGGGTGGCTGGCAGAATGAAAGGATTTCA
ACCAATAAAGCGTGGATAAAAAATATACAGCCAATGGAACGGCATTTGAGATATGGGTACATTGCTCATAAATTAACACCATGGTCAGGAGTGCAGGAAG
TGGTGGAAGACTTGCAGCAGTGGTCGAATCCGACTCGCTTCGACTCGACATCAGACCGATGCGACTTCAGAGGAGGAGCTAGAAACGTGGCGAGGGATGC
AGTCAATCAAAATACGCGAAACTACACACTGTTCGTGAGTAGAACAAGCGACATATCGGTTAACGACGACAAGGTCGCTTCTCGTCGAAGTTGAGCCATT
TGAGGCCGCACAAAGCTCCTCTGTTGAAAGCTGCCGTAAGTACCTATCCTGCGTTTTATCCGACTGTATAAGTTAGCTGCTTGCTCATTCTGATGGTAAC
CACAGCATGACAGAGCACCTTCCGGCCTGCTTACTGACTTCACTGTCGTGGTGATAGGCCACTTCGTCGCCTCTTAGCTCGTCTTGCACTCCACGCAGTA
GCTAATCGGCTCTATATATGTAAGCTGTTTTTCCAGATCTGTTTCCGAGTGACTCATGACTCTGCTGCTTGTCCGAACCCACCTGATGGCCAGATATCAC
CGCCGAGACTCACGAAAATGGTCAGCTCGCGTAGGCATCTTGATTATCTCTCTTGGGGTCTTAAAACGTTTGCGCTGGTCCATCGCGCGCACTTGAATCA
ACTCGGTGCCAGATGC