Description :
From Genome Similarity Track
Location :
Scaffold_35:35466- 41131
Transcript NameFunction/comments
Physo_134954reverse transcriptase

Sequence
5665 bases(100 bases per row)
TTGCGTATCCGGTACTGCGGTAAGGATATGTCGTTGGCCAGCCGATATTACCACGCGACGCAACGCCCCAACGAGACCCCGCTGGACTACTTGTACCGGC
TCGCTTCAGGGCCAACATCCCGTACGCCGAAGGCACGATCGAGGAGAAGCGCGAACATGTCGAACACTTCATCCGGACGCTGAACACTCAGGATGGAGAA
CTGGCGTCGCGCCCCACGCTGATGGAAGTCGCGGACTCCGTCGCACTGGAAAAGAAGCTGCGCGCTCAACAGCGTGGGCTGGTCCACCAGAAGAAAACTC
TCTTCGGCTCGAACAAGCTCCGCCAAAAGGCGCCGACCCCGTCGCCTCAGCCGGATCGCGCCCTTCACGCGATCCACGTCGCGTCGGACGAGTATGATTC
GGAACGCAAAAGGCACGACAGCGACGACCGTCAGTACGACCACGACGAGGAGAACGACGAGCGCGTCAAGTTGTTCGTCGCCGGGCTAGCCCCGCCCGGA
GAGACGGCGCGTCGCAACTTCGACTATGAAGACGCGGGACGCGAGCGCCCGCGGTGCCGCCAATGTGGCTCACGCCGCCATGCTAAAGGAGATTGCTGGA
AGCTGTTGACGTGTCAGAAGTGTGGTTGTCAACACCTGACGGAGCGATGCTTATGCAAGGCCTGTGGTGATGTGCACGAAGCCGGAGAATGCCCGATGGA
GGAGTTCTTCAACCAATTGTGCCAGTGGTTTGACCCGCACAAGCATGCGGGAATGCTGCCGCCGGTCGCCGAGAAGATGTTAAACTACGACGCTCGCTGG
CTTGGAAACCAGTACGAGACGAGCGACCTGTTTCCGTCTATGCATATGTGACCAAGAAGTCGCGAGAGGTGGTTAGTGAGAGCACGACTTCCCTGAATGA
TAATACATGTGAATCCAACCTGGAACGTACCACGCGAGAGCGCTCGCCGCGAATCTCGGCGGTCCGACGAACGACGGACGACGAGTTTGCACGTGAACCG
CCCCTGGACGAGATCGACTTGCAACCAGGAGAGCGACGCGGATATTGGAAACATTACGCGCCGCACAAGTGGTACAATCAGGCCAAGATTCATGGGAAGC
TGAACAACCGCCGTGCTGTGTTGTTATTCGACACAGGTGCCGAGGTGTCCATCTTGAACACCACCTTTGCTCGTGAGGTAGGCTGTCTGATCGACACGGA
GATCACACAAGAATGTGTTGGGATTCATGATGAGACATATTACACGGTGGGAAGAAACAGAGTCAAGATTACCTTGGCTGGGAACTTGGTGTACTACATG
CACCTGTGGGTCGGCGACTTGGTCGGTCAACACGCAATCCTGGGGATGAACTTCATGGTACCAGCTGGAGTGCGCATCGACACTGCGGATGGCACAGCGT
GCCTCCCCGACGAGGTGCACATCCAGACGATCGGACGAAGGCCGCTATACGGCGCACGGGTGCACTCGGTCAACGTCAAGACGCCTGTGAGACTTGAGCC
AGGAGACACGCATGAAGTCCCGTTGTGGCCTGACCGGAACGCGCCGCTCCTGTGGGTAACGCGGACAGAGTCATGGGTCACCACCTTTGTGACAGGGAAG
GTCGGAAGGAAGACGTACCTGCGCGTCACGAACGTAGGATACATAGCCATAACACTCGACGCTCATGCGACGCTGGGATGGTGGACTCCGGCTGACGCCC
TGACCCGAGCCCGCGGCTTCGTTTGACTTGGCTCACGCCGATATCAGCAGTGGCAGCATCTGGCGTACGGCGCGACGTGCGACGCGGAGTAAAACTGAAT
CCCTGCCGAGCTCCAAGGGCCAAAGCCAGATCGCCCCTCATACCCGACGCCTACCAGTGTTGGCGGCTGTCGCGGAAGCGCCGAAGGGATTAAGGGTAGA
GGTGCCGCCTGATGACCACATACGGAACACGGATGAGGAGACAGTCAAAGTCGAACCCGATGTACCTCCGACTGTGGCTGAAAGCGCTGCGAGGAAGGAA
TCGCCGGAGTCGAAACTCGACGAGCCAAAACCCGCCGAGCCGAAACTCGACGGACCACAACCCACAGAACGGGAACTCGACGAGGCGAAACCTGATGAAC
AGGAGGACAACGACGCGGTTCTCATCCACGAGGGGTCCGATCTCTTCGCAGAGGATCTGGAGTCCGAGCTGGCAGTGCTACCCGACCTCTCGCTGACTGC
CGAGGTGAAAGTCGAAGACTTGAAGGTGGGCACACCGACTGGGCTCCCGCCCGAAGAAACCGCGAAGCAAGAGGCACGGCTACGCCAGATCATCTGGAAG
CGACGGAAAAGGTTGATCGGCAAGGGCAACGCCTTGCCGCCGGCTGTCCTGGGGGTAGTCTGCGACATCGACGTGGGCGACGCAAAACCCGTCGCGCAAC
GCAACCGGAAAATCCCGCCGCGGTTCCGAGAGAAGGTCGCCGACTTGATCAAGGGGCTGCTGAGCGCGAGGATGATCCAGAAGTCGAAGTCGCCGTGGGC
GTCGCCCATTGTCGTGATCATAAAGAAGAACGGCGTCGATATCCGGCTTTGCATTGACTACAGGCTCATCAACGGGCTGACAAGGTTGTTGATTTACCCC
ATGCCGCTCGTCAACGACTTGCTCGAAGACTTGGACAAGTATCTGTGGTACTGCTCCCTCGACATGGCGAGCGGTTTCTGGGTCGTCCCTATGACAGACC
GGGCCCGGCTCATCTCGGCCTTCCTCACGCCGATGGGTCTGTACGGATGGCTACGTATGCCGTTCGGCCTGTGCGACGCGCCGCAGATTTACCAACGCTT
GATCGATAACGCGCTCTACGGGCTCCCGAAGCTGTCTCCGGATGGCAGCACTCTGGACGTGTTTGATGACGGCGAACCAGTGAAGCCAGGTATCCACTCC
GTTCTAGGTCGGAGGTCATCCATCGACGACATCCTCATCGGGAGCACGTCGTGGGACGATCTGTGCGAGAAGGCCGAACGCTTGCTGGATGTCTGCGAGC
AGTGGCACTTATCCATCAGTGTCGACAAGAGCGAGTGGGGCATGTCCAAGGTCGACTACCTGGGCCATCGAGACTCAGGACTCGGTCTCGAGGCAAAACC
GAAGTATTTGGAGTCGCTGACGTCGCTCGAGTTCCCACACACGCCCAAGGGCCTGCTAGCGTTCTTGGGCAGTTTCAATATACTACCACCGGTTCATTGC
AGACTTTGCGGTGTACGCAACCGCGCTGTATTCGCTGACGGAGACCGATTTCGATGAGTACATCACACGTCCAGAGGTCCGCGAACAAGCGAAGTGGGCC
CACGCGACGCGCGCCTTCGACGCGCTCAAGGCAAAACTCGCCGAGACTCCCATGTTGAAACACTTCGACGCGAATCGAGAATCCGTTGTGATCGTGTATG
CTAGCGACTGGGCCATCTCAGGGGTGCTCATGCAAGTTCACGACGATGTGTACATGCCTGTGAAGTTCACCAGCCGTTCGCTGAAGCCCCACGAGTTGAA
CTACGATGTCGTCGATAAAGAGATTTTGGCCCTGTTGCGCGTCTTGAACGAGTGCTACACGATGCTAGCGGGGAGACCAGTTCGCGTCTTGACGCGTCAT
ACGACACTCGCCTGGTTGTTCCGGTCCAAGGGACTACAAGGCAGACTGTCACAGTGGGCCGCGATTCTCTCGCCGTGGAAGCTGGAAATCTGCCGATCCA
TGAAGGGAGAAGAAGAACTCCTCGGCGCGCTGGCCGCGAGCATTACGCCGCGAGCCTTCGTCGACGCGGCGCTACAAGAGATCGCCCCGCGGACACGGGC
GTCGAGGATTGCGGTCATATCAGTCCCCGACGTGGCGCGCGACGAGGGCCTGCACGTCTTGAGCTTCGACAGATCGGCTAAGGCGAAGGGGAAGGCGAAG
AAGTCATCCGACCACGGGAATCGAGTCCCGAAATAGCGCCTCCAGCCGGTCGCGACGCGAAAAATCTCGACGCGAAAAATCTCGACGCGAAAAACCGCGA
CGTAACACCTCGCGACGCAAAATTGTGTGACGCAGAAGGCCATGGACGCGGGGCGCGAGACGGCGCAAGTCCTCGCGGTGATGACAGGCTCGGCCGCCGC
GCGCACGACAACACGTAGGGGCCGATCTCCGGAAGTCCTGGAAGAACGGGTGGTGCAGCAGCTGCGCCTGGACCGCATCCGGGTCGCCCAAGACGAAGAG
GTCTGGATCGTCAACCTCAAGAAGTATCTTCGCGGCGACGTCGGAGATCTATCTCAGCGCGAGGTGAAGAACTACCAGAAGCTTGCGCCCCAGTACGAAG
AAGGCAAGGGCGTGCTGCTTTACTACCAGCCGAGAAGCGACGGGTCCGCCGAGTACCGCGACGTGGTGATGAAGTTGGTGATCCCGGAGACTCTTTGGGA
GGATGTACTCCACCACTACCACGCGAGCCTAGAGGGCGGACACCAGGGCATTGGCCGCACGTAGCAGCGTGTGAGGCCGGTACTTCCACTGGCCAGGGAT
CTTCATAAGCGCCCTGCTCTATGTCGGCGAATGCACCGACTGCGAGACGGGAAAGGGTCGGCCGACCATCTAGGGCGAGTCGTCGGGTAACATCGTCGCG
ACGTACTCGTTCCAGGTCATTGCCATGGACCATATTCCGTCGTTGCCGGTATCCTACAAAGGCAACACAGAGCTGTTACTATGAGTCGACCTCTTCACGG
GGTTCGTCGCTGTCAAAGCAAAGGCATCACGAACCGCGCCGACGGTAGCCGAAGCGTACGAGGAGGCGGTGTTCAGGCACTTCGGCGCTAGCGAGGCAAT
CCGCCACGACCGCGAGCCAGAATTCATGTCCAACTTCTTCAAGGCGTTCAGCAAAGGCATGGGTCAGAGACAGCGAACGACGCTCGCTTATCGTCCCCCG
TCCAACGGCGCTGCAGAACGCAAGGTGCAGACGGTTACAAGAGCAATTAAGATGAACATCGCGGACGTCGACCAACGCGACTGGGACGAGTACGCCGAGC
GCCTTATCTTCGCGCTAAACACGTCACACGATCGGACGAGGAACGAAACCCCGTTCTTCTTAGTGCACAGCTGGGATCCTCGGTCGACGCTGGAAGCGAC
GCTAGCCGTCGGGAACACGTCAACCCGGGACACCGAGGCGAGGCGGTGGAGGCTCCGTATCCAGCGACACTACAGGTAGCATGAGCACAAGCGTTGGAGT
TAGTCCGAGAGGCTGTCGAAGAGAGAGCGCGTCGACAAACTGATAACGTGACGCAACACGAGATCGCGACGGGCTCGCAAGTTTGGCTGTACCTGGATCG
GGTGAAGCCAGGGTATGCGCGCAAACTCGCGCAAATGTGGCACGGACCCTTCCGCGTCGCCGAGCTGGTCTGCACGTTCGCAGCGCGCCTCGAGACGGCG
GGTACGCCCTACCAACTGTACCCCGTCGTCCACATCTCCAAGCTGTAGTTCGTCCGGAAATTCCCGTCGCGACCCGCGACGCAGCTGACGGTGCCGACCG
ATGAACGCTTCGACTTCGGCGAGGAGCTCTTACCGGAGGTCAGCTGGGAGGCTACACTCGAGCTGGAGGACGACGTCTTCGAGGTCGAGAAGATCTTGAA
CGTGCGCGAGGGGTGGGCTACCCGGTAGGGGCGCACGCGACGCGAATTTGAAGTGAACGCGGAGG