Description :
From Genome Similarity Track
Location :
Scaffold_3:354644- 355724
Transcript NameFunction/comments
Physo_314186HECT E3 ubiquitin ligase, putative

Sequence
1080 bases(100 bases per row)
TGGAGCAGATGCTCAAGTGTCCGCCTAGTCGTTTCTGGGAGCGGCTGCGTATTTACTTCGAGAACGAGCCTGGACTGGACGCTGGTGGTCTGATTCGCGA
GTGGTACGAGATTTTGAGTGACTCGCTGTTCAACGACGATTTTGGTCTGTTTATCTCGACGAAGGGTGAAAACATGGGCTACTGGATCAACCCCACATCC
GCCTCCAAGGTGCCGAACCACCTGGAGTACTACGAGTTTGTTGGCCGGTTGCTGGCCAAGGCGTTGATTGAGGGCTACAACATGAAGATGTCGCTGGCGC
TGCCTCTTATCAAGCACATTCTTGGCGTGCCCATTTCGTTTTCGGACCTGGAGTTCCTCGATGAAGATCTGCACAAGAACGCAATGTGGATGAAGCAGAA
TGACCACGCTGAGCTTCTCGCTATCGATTTTACGGTTCAGGTTATCACTTCCGAGGGCAAGTCCCACACGGTGGAGCTGGTTCCAGACGGCGCTGGACGC
GACGTGACCGATGAGAACAAGAAGGAGTATCTGGAGCTGCTGCTCAAGCACTATATGTTCGAGAGCATTTCGGAGCAGTTGGGCGCGTTGCTCATGGGTT
TCTACGACGTTATGCCGCAGTTCCTCATCACGGTGTTCGATTACCAGGAGTTCGACTTGCTGTTGTCTGGTGTTCCGGAGCTTGATGTCAACGACTGGCA
TACTCACAGCGAGGTTCGCTGGATAAAGCTTGAGAAGCCGACTCCTGTCGAGCATCGCGTACTCAAGTGGTTCTGGGAATGCATGAACGAGTTCACGAGC
GAGGAGCGCGCTCGCCTGCTGCAGTTCGCCACCGGCACGTCTCGAGTCCCGGTTCAGGGTTTCAAGGCGCTCATGAGCAGTGACGGCCGTGTCCGTCGAT
TCACTATTCAGTTCGTGCAGCGTGGAGCACCGCCCACGGGTCTCATGCCGAAGGGCCACACGTGCTTCAACCGCATCGACCTGCCGCTCTACCACACCAA
GGAAGAGATGATCAACTATCTGACGCTTGTGATGAACATGGAGATCTCGGGCTTCTGGATGGAGTAGACTTTAGTACGCC