Description :
From Genome Similarity Track
Location :
Scaffold_141:35451- 36776
Transcript NameFunction/comments
Physo_143496hypothetical protein

Sequence
1325 bases(100 bases per row)
TCAGGAACTCCTCGATGAACGGGGAGCGAATCGAAGTCAACAGGTGCGAGTGTCCACGCTCATACAACCACGTGTACAGCAAGTTGTGGAAGCTATCGTC
CTCAGACGCCAGCGCAAAGTGGAACAACTCTTCCACGAACTTATTCCGCGTGTCGTCATCTAGCGTCACCATTTCCTCCACAGCTTGAGGGCTGGCACCG
TTCGCCGCAGCACGAGCCGAGCTGTTCTTGTCACCGGCCTCACCACCAAGAAGTCGGTGCAGAGCCAACAAAATGCAGCCGAAGCACCGCCGTTTCCATG
TCTGCTTGACACCGCTCAGGTCCGAAGCGCCGGCATCGTGGAAGTGCTTGGCACATGCTAGCGACAGCTTAACGACACCTTCGTAGTAGTTCAGCAGCGT
GTAGTCTTCGCAAATTCCCTGTAAAACATCCAGGCAGTCCTCCGTGTCCCACATGTGGCATGAGTTCAGGAACTGGTCAAGGGATTCCTTCAAGAAGTTC
TTGCGAGCAACGGGCGATCCACTGAGCTTGGCATTCGACAAGCTTCGGTATCCTTGGTAGTGCCAGAGGTCAGAAACAGAGAAAAACGTGGGGCACTGTT
CGCGAAGCTGCTTGATCAGGAAGTGGTTGTTCTCGTTGCGGCCGCGCATCAGCGCCTTCGTCATGGTCTTGGCAGCCAGCGAGCCATCCGTCGTAGTCAC
CAATTCGCTGAAGCTCAGGCGGGCGAGGGGCTCCTCCAGCGACACCTTGTACTCTTGTGCAATCCGCAGCAGTGAAATAGCCTCAATACTGCGCAGAACC
AACTCGTAAAGGTAGTACAGGGAGCGCTGTTCGGCCTTGAAACGCGTTTCACGCTTCAGTTGATCTTCGCTCAGGGACTTCTGGTGGCGCATCACCAGCT
CCGACACGCGCGACAGGCCAGCCTCAGCACTCTCGCCCAGAACACCGTCCAAGCTCGGGTTGTTCTCCAGTGCAGCGCCGCCGCTAATTGACACAGCAAA
CGGTCCTGCGCTTTCCATCAGTTGCCGCAGCTGGAACAGAATCTCACGGATCTCGTCCAGCTTCTCAGGGAAATGGATGTTCTCGAAGCTAGTCACATAT
CCTGGAGACTTGGCCGACGACTTAGAGCCGTTAGCAGCATTGGCGGAGACGCGAGAAACCACGCGACGGCCTAGAGTCTTGGATGTCCAAAGCGGGCGAA
GAACACGGGAAGCGAATGCGACCAAACCGTCGTGCTGGTACGACATGCCGAACTCCGTCGTAAGCACGATACGCGTGCTACTCGCAGTGCTAGATGCACC
GTTGGCCGTAGAGGTAGCAGCGGGC