Description :
From Genome Similarity Track
Location :
contig_21:354481- 356897
Transcript NameFunction/comments
g3885.t1Exosome complex uclease

Sequence
2416 bases(100 bases per row)
GCGAACGTAGTGACCCAGAGGGAACTTGCTGTCCGCTGGCCACGAATCAATTGCCACAAGAATTCGCTTGTCCATAAGCGTCTCCTGCTGGCGCGTCTGG
ATCTTGATCTTCGGAACCTTCCTGTCCACAGGCACCACGAGGCAACTGCCAGAAGCATTGAAGGTCGCCGTCGCGCGGAGCCTCAAGAGACCCGCAAAAC
TTACGCCAGTTGCGCTGAATAATGCCCACAACGCGGCCAGCAGGCTTCGCGTGTTGAGACGCATCGCTCTGGACAAGCGCCACCTGCTCCAGCGAGACCG
TGGGTTCCGCCACTCCGACAGGTTCGGGCTGCGCAACGTCTTCCTTGTCATCGTCAGCCACCTCGGCAGCCTCCGCTGCAGCCGTTCCATTCGCTGCAAA
CGAGTCGGACGGCTTCTTCCACTGCTCCTTTGGCAGCAGCTGAATCGCCACCAGATCGCCATCAATCGCGCGGTTAATATGCTCGCGGCCTTGCAGTAGC
ACGGGGATCTTGACGCCATTCGCGCCGTGAATCAGCACATGACACTCCAGCCAGTGGTCTCTGTTGCAGCGAATCGTGCCCTTAAAGTACCGCTTGTTCT
TGATACCTGCCAGCAGCTCCGCAGCTGACATATGCTCCGGGTACAGCTTCTTCTTGCTGTGACGCCCAGCCGAGCTGCTCACACCTTCTGCCGTGATTTC
TTCTCCTCTGCGGCTGATGCTGACAGCAAATCCTGCAGCTCTGGGAACTGGGCCGCCACAGGCTTCACAAAGTCTGCAATGGTCTTCCCACCTACGACAC
CAAACTTCTCGGCGTGCTGCAAGTCCTCGGCGTCGTTAGCCAGGAACAGAACCTTGACGTCCTGGCGCTGCAGCTGCTTCAGGTGCTCGGCGTACCATCT
CCAGGCGGTGGCCACGGCGCGTTCGTTGCGCTCGTCCTCCGTCTCGATGGACACTTGGTCCTCCAAACTGTCCTCCTGATATCCTCTGGGCAATAACTGT
TTCTTCTGCACGTAACATGCACGATGGTGCTCATTGGCGAACACCACAAAGCGCCGGTCCACATTCATGAGCAATGCGCGCAGCCGGTTGTACACTCCCA
GGTCCTGCCGCTTCACAAACTCCCAGACCGTTTCGAGCACGAGGACATCAGCAAACACTTGGTGTCCGCTAGTGTCCACCTTGGTTTTTTTCTTGGTCGA
GAACTCCAAAACGTCCATCTGCAGCAGGAACGTCTTCATAGACGGCAATAGATACACCCCGTCGCGCGGTGTGTCCGCCAGCACCGTCTTGGTCGTCCCC
AGCACGTGCGTCGCAGCCGACGCGTCATCCTCGGCGCTGCACAGCGCGCAATTGGGCAGCGAGCAGCTCAGGTCGTCCCGTAGGTACCTCTCGCGCACTT
TACGTACGATACGGCCGCGCCTCGTAGCCACGTTGAGCTCATCCAAGCACCAAGTCGGCGGTGTATCAACGGCCTCCATTGCGAATGAGCTAATGGCGGG
TGGCTGGCAGAATGAAAGGATTTCAACCAATAAAGCGTGGATAAAAATATACAGCCAATGGAACGGCATTTGAGATATGGGTACATTGCTCATAAATTAA
CACCATGGTCAGGAGTGCAGGAAGTGGTGGAAGACTTGCAGCAGTGGTCGAATCCGACTCGCTTCGACTCGACATCAGACCGATGCGACTTCAGAGGAGG
AGCTAGAAACGTGGCGAGGGATGCAGTCAATCAAAATACGCGAAACTACACACTGTTCGTGAGTAGAACAAGCGACATATCGGTTAACGACGACAAGGTC
GCTTCTCGTCGAAGTTGAGCCATTTGAGGCCGCACAAAGCTCCTCTGTTGAAAGCTGCCGTAAGTACCTATCCTGCGTTTTATCCGACTGTATAAGTTAG
CTGCTTGCTCATTCTGATGGTAACCACAGCATGACAGAGCACCTTCCGGCCTGCTTACTGACTTCACTGTCGTGGTGATAGGCCACTTCGTCGCCTCTTA
GCTCGTCTTGCACTCCACGCAGTAGCTAATCGGCTCTATATATGTAAGCTGTTTTTCCAGATCTGTTTCCGAGTGACATGACTCTGCTGCTTGTCCGAAC
CCACCTGATGGCCAGATATCACCGCCGAGACTCACGAAAATGGTCAGCTCGCGTAGGCATCTTGATTATCTCTCTTGGGGTCTTAAAACGTTTGCGCTGG
TCCATCGCGCGCACTTGAATCAACTCGGTGCCAGATGCGTCTGTCCAGTCCAGTGCACGCTGCATTACCACTGCGCCTTTAGTTCGTGCAGCAGGCCGGG
CGTGTGGGTGGCAGACGTGCTCGAACAAACGATATAGTTCGGCATTTGTTGGGCTTGAACTCGTTCGAGCCACTCCCGAAATTGACGTCTTGAGATCACC
AAGCTTTGCCAACCTC