Description :
From Genome Similarity Track
Location :
Scaffold_47:354422- 355992
Sequence
1570 bases(100 bases per row)
GATTCCATCTCCACGTCCCGCGATCCAACGTTGTCGTCGACCACTGGAGTAGGTGTTACCACCGTGGCCTGTTGTTCCTTCAGAAATCGAGCCATCGCAG
CCTGAAAGTAAGACTCCAGTTTGCCATTCGACTCATCTGATCCGGTAGCACTGGTGGTCCGATCGGTCGACTTGGGTTTCTGCTTCCGAGGTCCTGATCG
CATGCGTTCCTGACGTTGACTCCGTGATCGTGCGTCCAACATCGCAGATCCTGAAGGGCCGAGGGACATCCGTTGAGGTTCAGACGACGTATCCGATACA
TGTTCCGCTGCGGAGACATAAGGAGACGACGATCGGTACCCAGTGGACTCCACTCGCGGCGATGACACTGGAGCCGGCGATACTAGATCTGGCACCTTCA
GGTCCGGACTGTCCGCGATCACGTCGACCAAAGGTCTCAACTTGTCGACCAATGTCCGGATCGCTGTCTGGATCACATCGAGATCTTGATCGAAAAGATC
GTTCGCTTCAATGGCGCCAACCACGTAGCCGGCCTCCTTCAACAGCCCGAGCAGGATCTTCACCGCCATCAGCTTGTTGTCCGTCACTCGGGGGGGGTCG
AGATCGGCCCCTTCGAGACATCGATCTGCTCTGGCCGCAAGATCACCATGACAGGATCTTGACGCAAGAAGTCTCGCAGTTCCTTCAAGTGATACTGACG
ATCCAGGTCAGCCTCGGACCAGTCGAGCGCCGACGGTCTGGGATCTTCGTCGTCCAGGCCTGGCGCTCTCAGCTTCTTCTTCACGATCTGGGTGTTGTTC
GCGATCGCGTTCAGGTAGTCCGGATCGAGCCTGATCGGCGAGTCAGCGAACGCGTATCGGTCCGATCCCGCCTTAGTTTGTTTTGTTAGTGAATCTCGGT
TCGCACCAAGATCCACCGGGGTCCCCGCAGGGACCTGGGGAGGATGTTGAGGTTTGTCTTCTAGATCTGTCTCCAGATCGCCCTCGATTCCGTCGACAGA
AGTCCTCCGAGCACTCTGTCGATCTGCGGATCTCGTTTTGTTCAGCAGCGTCTTCGTCGATCCGATATCCGACGACGCCTCTTCCCCTGGTTCTTTCTTC
ACTTGCACATCTTCTACGGACTCACGGTGATATCCGGAGTCCCCAACAGATCCGGGCACGCACACCATTGTGGTGTAGCGGGATCGGCCAAAATCTGGTT
AAGGCCTGATCGAGCTTCCCACCAGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCAGTGATCCGTGATCGGCTGAACTTGTTCTCACCTTGTGTACC
CGTCGGCGGGCTGGGTCTGCTCTTTCGGGGCTCCGAAGATGCAGCACTTGGTGAAGATCGAATGTCTTGGCGTGACGCGGGGATAGGTTGTGGAGCAGTG
CGGGAATCGTCGCTCTGCGACCGAGTATACGCTCCGATCGAGGGTTGTTCGCTCCGATCGGTCGACCTTGAGTCGATTCACGGCCTGTAGTTACCTTTCC
GGGTGTGTTCCTCCCTTTCCTGAGTTGCTTGCCGCTTCCTATAGCGGGATCGAGGTTGATCGAGAGAAGA