Description :
From Genome Similarity Track
Location :
Scaffold_33:354400- 355768
Transcript NameFunction/comments
Phyci_222138conserved hypothetical protein
Phyci_221931tubulin polyglutamylase putative

Sequence
1368 bases(100 bases per row)
AGGTGGCGGTCTCGGTGAATACGAACTGCAGCTTCGATCTTCAGATGTCCGTAGGGCAGACAATAGCTACAATGAGCGCGCGTCCGAGCCGCATCGTCCG
CGCGGGTTGTCGGAAGGCAGCAGCGCCGACTGGGAGTCGAGACGCACGCGCTCCAGGCTGTCCAGCGCCAGCTCGACGACCGGTGTGGCGGGCTTGACGC
TGCTCAAGAACATTGCGACCACGTCGTACACGTTCGTGGCGAGCAAATACCACCAGGGGCAGCCTGTGATCACCAAGTTCGGCGCCGGACACATCCTTTC
TGTCGACCCGCAGCGTGCCACCGCGCAGGTGCAGCTGGTGTGGGGCGCCATTGCTTTCCTTAACGCTGACATGATTGATTTCTACCCCAAGGCGCTGGAG
GGCACGGACGTGCAGACCAAGTTTGGCTCAGGTGTAGTTATCGGACTGCGACCGGCGGATGCGATCTACACGGTGCGCCTGCACGACCCGCAGCCCGCCG
GCAAGTCTGACATTGTATTTGTGCACGAGTCGGACCTGCACCGGAGCCGGAGGATCGTGGTCACGGCTGCGAACGTCCGAGACAGGCTCAAAGCGATGGC
ACAGCGGCGTTTCGGTGAACGCATCGTGGTGGCGCACCAGCACCACGACGAGGAGCCTAATTCCGCAGGCATCTAGCCCTGATCAGCCGGTCCAAGCAGC
GACTGCTGACGACGGTGCCTTGGAGTTCATTTTTGATGGTGAGCAACGGAGTGAGTGAGCGAGAGTGCGTTTCGAGGCCCTGTCCTTCCTCCTCCTCCCC
CTCCCCCTTTGTTTGTTATTGTGAGTATCTTCACCAAGTAAGTCCCCCGACACCACCACACATACGCAGCCGAGCTATGTAGCTGCTCTGATAGTCAGCT
GAACTTCTATTGAGTGCAGCGCCAACCAGACCAAACGAATTCAACACAACCCCTAACTGACCCAGTCAACGAGGTACAGACAAATGGCGATGCCAATACA
TACCGCTTTGTTCCAAGGGAGAGGAAGCAAAGGATAAAAGACAGCGTTCTCTTCCATTTTGTGTAGCAACTCGATAGAAATCCTTAACTGCAGCCACCAT
TAGCGCTTAGACCGTGCTAGCTGTCCTATCAGGAAATCACGATTGCGTACTGCCTGTGCCCGATCGCGTTGCTGGAGTTCGCTGCCAGTCCGCGCCTAGG
AATGTCGTGTACATGCAACTTTCGCTCTTCTTGACAACATTTCCGTCACGATACACGAGGTCAAAGCCCCCGACGTGCTCACGAACGACACCGTCAGGTT
TTCTAGAGCAAAGCTGTCAAAAACTCTGCAATTTTCTGCATGATCGAAGTACTCAATCACGTACTTAT