Description :
From Genome Similarity Track
Location :
Scaffold_965:3544- 4555
Transcript NameFunction/comments
Phyag_g8893hypothetical protein

Sequence
1011 bases(100 bases per row)
TAATCCGGATGTTGCCTCGTTGCTGCATGGATTGATTCATATCTCTATTCGTCGAGGTTTTGAGTATTTCCCTATCATTCGCTGCCTTGTCGAGCGAATT
GTGGAACAAGTGCCGACTCGATTAACCAGATCGCTCTCGTCTgtgtcttcaacttcgacggTATCATCGACGTCATCAGCGTCACCACGATCGTCATTTG
GTGGATCTCCGAGTGTGTCGCTGTCTTCTTTTTTCTCGTCCAAAACAGCTCCTCTGTCGCCGTCGTTATTTACGACAAACACGACTTCGACAGTCCATTC
AAGGATAAGTGGATGCGCGGAGATTTTGTCGAAACTACTGCAGGACGAATTCCCGAATACTTTTCGGTACTACATCCAAACGAGGATTCAGCTGGCATCA
TTTGAGAATGTGGAAACGTTTGAGAAGGAACTTTTCCCCCCGAGAATGGCTCCAAGTGATCCTGCCATGCATCATAAACTAAAGTGTGCAGTGATGGCGG
CTCTGATGGAGAACTCGACCGTCCTTGCCCGACTGACAGAGCTTGGAATGGCAGAACTTCGGTTTTTGGACGCACACCACTTGAATGGAGCCTGCATTCC
GCGGGTTCTCGTGATCGATATTTTGCGCTGTGCTATCGAGTTCTCGCTGCATGATTCTGAACAGTTGGAAGCGTTAATTGCTCCAATCCACCTCGTCCTG
GATACAATTTGCGCGTCGATCAACTACCATCAGCACCTGTCTACGATATCGGAATTTGCTGCGCGTGATTGCTTTAGTGATAGCGACTCTGACAATGACG
GAACAGAGGACGGCGAGGAATTTGATGGACTTGCCTGTTCGAGTGTAAAAGACAGTCCGATCAAGCCCGCGAAGCGCCGTGATGTGTCACCGGGGCGAAG
TACGCTGTATATGGGAGCCAATCCTCCTGCTTTGAGCTATTCACCTGGATCGGGAAAAGCATTTGTAAATCATCGGCCTCTAGCAGCTACTCTACTGGTG
ATGCacgtggt