Description :
From Genome Similarity Track
Location :
contig_149:3543- 4891
Transcript NameFunction/comments
g14346.t1XP_009846822.1 hypothetical protein H257_19374 [Aphanomyces astaci

Sequence
1348 bases(100 bases per row)
AGGGCTTCAAACAGAAGTACGGCATCGACTACACGGAGACGTTCTCGCCCGTGGTCAAGTACGTGGCGCTGCGCATGATCATCGCGATCGCCAAGTACTT
CGGCTGGCCTCTCGACCAACTCGACGTCGTGACAGCGTTCCTGTACGGGGTCATGAAGGAGGTGGTGTTCTGCGTGGTTCCCGAAGGCGTCGAACTGGAT
GGTGGCTTCGACTGCCTGGAACTGGTAAAGGCCATCTACGGTCTCAAGCAAGCTTCGCGCGTGTGGAACGAGACCTTCGACGAGTTCATGTGCTCTATCG
GCTTTCAAGTGTCGGCCTTCGATCCGTGCCTCTACATCAAGGTGGTGGACAGTCACTGCGTGCTCGTGCTGGTGTACGTGGACGACGTGCTGATTACCGG
GAGTTCGCCTGAGCTGATCGCACGCACGAAGACGGACCTGAAGACGCGCTTCGAGATGACCGACAGCGGCAAGTGCGCGTTTGTTCTTGGGATCGAGCTG
GTGGACGGCCCGGACGGCAGCGTGACCATGTGCCAGCGTCGCTACGTGGACGACATCCTGAAACGCTTCGCCATGGACGAGTGCAAGGCTGTGGTGAGTC
CGGTGGACATGAGCACTCGACTGGTTCCAAGCGACGCGGCGACCAAGGTGAACGCTCCGTTTCGCGAAGCTGTTGGTGCGCTGATGTACCTGATGACCGC
CACGCGCCCGGACATCGCGTACGCCGTTGGCTATGTGTCGCGTTTCATGGAGAACCCCCAAGAGGAACACTGGGTTGCGGTCAAGCGCATCTTTCGCTAC
CTGCAAGGCACCAAGACGCATGACATCTGCTTCAAGCCGGGCGACAAGATCGACTTTCGTGGCTACTCGGACCGCGGACTGGGCCGGCGACCTCGCGGAC
CGCAAGTCCACTTCAGGCTATACGTTCATGCTGATGAGTGCGCCTGTGAGCTGGGGAAGCAAGAAGCAGTCAAGCGTGTCGCTGTCTACGAGCGAAGCGG
AGTACATCGCGCTCAGTCTGGCTATCCAAGAGGGCAAGTGGATCCATCGCCTGCTGTGCGAATTCTGGGGGCTGCCAACGAGACGGGACCGAGCTCATGA
TCCGTGAAGACAACCAGTCGTGCATCAAGATGACCAAGAACCGGTGAACCACGGCCGCGCCAAGCACATCGACATCAAGTACCACCACATCCGCGACGAA
GTGAAACGCGGTGAAGTGAAGCTCGAGTATTGCGAGACTTCTGTGATGCTGGCGGACATCATGACCAAGGCGCTTGCGGACCACGCCACACGGAGCTGAC
GGCGGCTCTCGGCATTCATGGGACTTCGCATTGAGGGGCGTATTGAGG