Description :
From Genome Similarity Track
Location :
contig_149:3543- 4891
Transcript NameFunction/comments
g13827.t1CCA24845.1 PREDICTED: copia proteinlike putative [Albugo laibachii Nc14

Sequence
1348 bases(100 bases per row)
AGGGCTTCAAACAGAAGTACGGCATCGACTACACGGAGACGTTCTCGCCCGTGGTCAAGTACGTGGCGCTGCGCATGATCATCGCGATCGCCAAGTACTT
CGGCTGGCCTCTCGACCAACTCGACGTCGTGACAGCGTTCCTGTACGGGGTCATGAAGGAGGTGGTGTTCTGCGTGGTTCCCGAAGGCGTCGAACTGGAT
GGTGGCTTCGACTGCCTGGAACTGGTAAAGGCCATCTACGGTCTCAAGCAAGCTTCGCGCGTGTGGAACGAGACCTTCGACGAGTTCATGTGCTCTATCG
GCTTTCAAGTGTCGGCCTTCGATCCGTGCCTCTACATCAAGGTGGTGGACAGTCACTGCGTGCTCGTGCTGGTGTACGTGGACGACGTGCTGATTACCGG
GAGTTCGCCTGAGCTGATCGCACGCACGAAGACGGACCTGAAGACGCGCTTCGAGATGACCGACAGCGGCAAGTGCGCGTTTGTTCTTGGGATCGAGCTG
GTGGACGGCCCGGACGGCAGCGTGACCATGTGCCAGCGTCGCTACGTGGACGACATCCTGAAACGCTTCGCCATGGACGAGTGCAAGGCTGTGGTGAGTC
CGGTGGACATGAGCACTCGACTGGTTCCAAGCGACGCGGCGACCAAGGTGAACGCTCCGTTTCGCGAAGCTGTTGGTGCGCTGATGTACCTGATGACCGC
CACGCGCCCGGACATCGCGTACGCCGTTGGCTATGTGTCGCGTTTCATGGAGAACCCCCAAGAGGAACACTGGGTTGCGGTCAAGCGCATCTTTCGCTAC
CTGCAAGGCACCAAGACGCATGACATCTGCTTCAAGCCGGGCGACAAGATCGACTTTCGTGGCTACTCGGACCGCGGACTGGGCCGGCGACCTCGCGGAC
CGCAAGTCCACTTCAGGCTATACGTTCATGCTGATGAGTGCGCCTGTGAGCTGGGGAAGCAAGAAGCAGTCAAGCGTGTCGCTGTCTACGAGCGAAGCGG
AGTACATCGCGCTCAGTCTGGCTATCCAAGAGGGCAAGTGGATCCATCGCCTGCTGTGCGAATTCTGGGGGCTGCCAACGAGACGGGACCGAGCTCATGA
TCCGTGAAGACAACCAGTCGTGCATCAAGATGACCAAGAACCGGTGAACCACGGCCGCGCCAAGCACATCGACATCAAGTACCACCACATCCGCGACGAA
GTGAAACGCGGTGAAGTGAAGCTCGAGTATTGCGAGACTTCTGTGATGCTGGCGGACATCATGACCAAGGCGCTTGCGGACCACGCCACACGGAGCTGAC
GGCGGCTCTCGGCATTCATGGGACTTCGCATTGAGGGGCGTATTGAGG