Description :
From Genome Similarity Track
Location :
Scaffold_1:35422- 38662
Transcript NameFunction/comments
Phyke_g144hypothetical protein PHYSODRAFT_553039
Phyke_g145hypothetical protein

Sequence
3240 bases(100 bases per row)
CTACTGGACGTACCTTGATATGTCCGGTTGATGAAAGTAGGATGTTGTCGGGTTTCAGATCTCTATACATTCGTATGCCAAAGACCAGACAAGTGGGATA
GTCAAACGCAAATGTTGAGCATAATTGCGCGATTTCAATTGAAAATAAGCAAAGCTGTTTTTCAAACCTGTGGACGCATCCTTTCATGTGCAGGTGGTTT
AATGCGATTGCGATCTCTGCAATGTAGACGCATGCCACCTTTGTACGCATAAGTTAACATTAATCGGCGATACTGCACACAGATAGAGAGCATTTACACA
AGTTTGCAAACTCACCTGCTCTTCCAACTGCACAATACACTCCAGAAGGGACATGAAGTCGCCTCCAGGAAGATACTCCATGACTAAGAACAGGTTACGC
CTGGTGACACCAACATGACAAATTTCTCCAGTGTAAGCACCTACAGTGTGACAGAGCCCACAAGTATGAATGTCCCTGCTTACTTGGTTTGGAATGTCCA
GAACAATTTCACGACGAATGGGCTCACCACACTGGCCAGAATATTTCTCTCTGTTTCAATTTGCTGAATCTGTTGGCAATAAACAAAGGGACCACAATGG
CATACACTCAGTAAACGGCACCATGGGCACGCTGCACTACGCAGGTCGTGTTGTACCTGCTTCTTTCGAAGTAAGTGCTCCTTCGCGAGCACCTTAATCG
CATACTGGTCGCCTGTGGTTTTTTTTTTGGCCAGGTATACCTTGCCGAAAGCTCCTTTCGAGATCGGCTTTATGATCTGAAAGTCGCGAATAGAAACACG
ATAGGAAGAAAGCTTCAAACTGCTCCGGCGACGTGGTGTTTTAACCCCGCTGTTAGtctcgagctcctccagtGACTTGGTCCGCTTAAAAGGTGCACGC
ATGATCTCGCCCGGGTTCTGCTGTAGCATTACCTTGTGCGATGCACGCATCTTGCTCATCTTCGTATGGATCAAGTTGCGCAGCTTGGTGCAGTACTTGA
CCCCTCGCTCTATTGCATAGTTGGGCGAATCTTTTTCCTGCTCCCGTATCCGGTCTATGATTTTCACCAATCTGGAGCATAACGCGAACGAGTCCACACT
TGTGACATCACATGTAGATGCTTGGATCGCTGCCACACGCAACGCATGGTAAATATGCATCTCTTCCTGACTAAACATGGGTCTCATGGCCTGTGTGTCC
AGATTCGCAGAAATTGACGCCGTCAGTTTGGCCAGCGAATTGTTGATCACATCCGCCTCCAACTCCACTCGTTTCGACAAGACACAAAAGTTGGTGTGTT
CATCCAAACTGTTTGCATCCACTTTGGTCTCACAGAGTTTGCAGACCACTGACTTGGCAGATTTTTGGAATTTCACAGTCATGGGGCGTTTACTGAACTG
CAAATTATCCAGTACGTCTTCAGGTGACATAGCGCTCATATCTTGTCCATTCACAGCGTCCACTGCCAGACCTCGTACCAGATTCACTCCCGGAGGGATC
AGCATTATTGCATTCGAGCCGGAATCATTCATCACATTTTTGATCAAAATCTGGTTTTTCGCCGTGTCAAACACGAATTCTAGGCCTAGAAACCCGTCTC
CGAATGTCACATCAAAGGTCTCAGTTCTCGGGACGTCTACGAACAGGTCTCCGTCCTCAAGGAACAGTGGAGCGTCCATAGAGACGTCTTCACCCAAAGC
TTCCTTCAGTTCGTCCCCACTGGCCGTAAGTCGTCTCCATTTCACCTGATTCTTCTCCCAGCGGTCCAGAACGTCCTCTGGGACACCTGAAGACGTGTCT
GGCAGTCCACTGCGTGTGATGGAGCTGCTAGTGGGTGGGACACTGAGTGTATACTGtcgttgcagcttctgcggtttgatctccagctccattTCTTCGT
GTAGTCTCTCcagatcgctgctgctggcgctgctgacgctggtTCGTCGACTGCTGTCCATGGATGAATCGAGTTCTGCGACGCGCGCTAAGGCGAGTTG
TCGATCGGCCATATTGAATGCCGGCAGGACCACGTACTAGTAGCAGAGTAATTTCAAGTGTGTGAAAAGGGATGAGGCAGGCGATTGTTGGCGTATTTTG
CCGCTTTTTCGATCTTTTTAGTTATTGTTCCTTTAGCGGCTTTTTGAAAacacttggaatttgtatgcACAACTGACTGACGATCAAGCCATCTAGGGCA
TGTTAGCAGTATGTTATCGACCGGTCGCCTTAGAACTTCTACTGGCTTTTGGTTGCGCCTTTCCGAGTAAATCTATATCTATCTTACCTTTACAAGAAGT
ACAGGTGCTCCGTCCAAATACATTTGGCACTCGGGTTGCGACTCAAATGCCAATTTCCGGCTATAAATTGCAAGCCAAACGCCACTAACTTACTATCGGA
TACTTAGTTAGTGCCCAAGTCGAAATCGAAGCATGTTAGATCAATGTGAGTGGAAGTTCACTGAACAGCCCTCGGCCGTCTATCTTGCTTACTAGATGGT
CGTTGTCATTGCCTCTTGAGAGGATCTGTAGTGTCAAACATGTATCGGTGCTTGTCGACCTTGTCGACCGAAATAAACGCAAGCGACTATCGGCATGAAC
GAAGAAATCGCTGATTCCTAGCCTGGTAGTACCTATGTTTGGGTATCCACAGACTGACGAAGTACGGCTTATGGTATCGGTGTGAGGTCGTCATCGTTcg
tgggggggggggggggggggtgaAAACCGCATCGTTAGCGCCGTTACTGTGAGTGGCAGCACCGGGTTCGAAGCGTCAGATCCGAATGGTCCGTTGAGTA
ACAATCGCTGCTCTTGTGATTTGTGGTATTTGCAGTCTGTCTGCCCAAAACTGATCGATCAAGCGTTCGCTGGTAAGCTTCCGCTCGTTGCCAAGACCAC
CGAGTTCAACGGCTGGAACCTTCTTTCTGCAGTTCTGAGCACGAAAGGCGCAACGGACTACCGGCTCGAATCCAAAAGTGACGATCTTCAGGAGATTCGA
CTAGTCTGAGTCAGCGAGAAACGATAAAACATGCAGTGCTGATTCACGTTACACTCAAGTAGATCGTTAGTTGCAACCTTACTGCGTGGTTGGCACTGCT
CTACAATCATACGCCATACGCCGCACGCTTGAATCCTCGTCCCTCTTTTCCATGACGAACaattgtcgtcgtccagaGGCTCTcgatgtggtccacaaac
TCACGAGTTTGAGCAGGTCGTTGAGTTAAGGTTCAAAATC