Description :
From Genome Similarity Track
Location :
Scaffold_105:35418- 38504
Transcript NameFunction/comments
Physo_141900ATGSL10 (GLUCAN SYNTHASE-LIKE 10); 1,3-beta-glucan synthase

Sequence
3086 bases(100 bases per row)
TCGTTCTTCACGGCCAGCATGTATGTCGTGGGCGCTCTGTTCGGCAACGACGACGCCGATGTGATCGACGGCTTCCGTCAGATCGAGGAGATCGCCGCGA
GCGGTGGTTTCCTGAAGTCGTTCAACGTGCGTGAGCTGGCCAGCCTTCGCGTGGCCGCCGTGGACCTGCTCGAAGAGATCCTGGACCTGCCGGACCCGGA
CGCTCAGTCTCAGCACATCCCCGACGCGCGCGTGCACTCGATGGGCGTGATTCGCAACTTCGTGTCCAAGATGGAGGCGTTCCTCAACGGCGTGCAGTCG
TTCTGCGTGGACCCTGCTCTTCAGCGCAGATTCGGCAACTCCAAGTTCTGCTCCAGCGCCAACGGATACATGTACGCGTCGCGCGGACTGGTGAACCTGT
TCTGCAGTGACACGGCTATGGGCGCCGCTACGCGTGCGTGTCTGCTGCTGTCCCTGGACCGATCGGAGGCCATGCCTCGCACGACCGAGGCCCAGCGTCG
TCTCGGTTTCTTCATGAAGTCGCTTGTCATGGACATCCCGCAGCTGCGTTCCATCAAGGAGATGCGCAGTTTCTCGGTCGTGACTCCGTTCTACGCCGAG
ACCGTGCTGTTCTCGCTTGAGGACCTGAACAACCCGCTCGTGAACCACCCGATCTTCCAGCAGGTCGAGGAGGACGGCAAGAACCTGACGATCCTCAAGT
ACCTGACGAAGATTCACCAGGAGGAATGGGACAACTTCCTCGAGCGCGTTGACGTGAGCTCGGCGGAGGAGGCCCAGAAGAACCACCCCGAGGAGATCCG
TCTGTGGGCGTCGTACCGTGGTCAGACCCTGGCGCGTACCGTGCAGGGCATGATGATGTACGAGGATGCGATCAAGATTCTGCACTGGCTGGAGATCGGC
TCGAGCCCCGGCAAGTCTGCGGAGCAGAAGCAGTCGCAGCTGCAGGACATGGTTCGTCTGAAATTCTCGTACATTTGCGCCTGTCAGGTGTACGGCAAGC
ACCGCGCGGAGGGCAAGGCGCAGGCTGCGGACATTGACTACCTGCTGCGCGAGTATCCGAACCTGCGTGTGGCGTACGTTGACACGGTGGTGCACGAGGA
TGGCGAGAAGTCGTTCGACACTGTGCTGATTAAGAGTGAGAACGACGATATTGTGGAAGTGTACCGTTACTCTCTGCCTGGCGACCCGATCCTCGGTGAA
GGTAAGCCCGAGAACCAGAACAACGCCATCCCCTTCACGCGCGGCGAGTTCGTCCAGACGATCGATATGAACCAGCAGCACTACTTTGAGGAGTGTCTGA
AGATGCCGCAGCTTCTGTGCACGGCCGACCTGCACCCGTCGAAGAAGCCCGTGTCGATCATCGGTATGCGTGAGCACATTTTCACGGGTAACGCCAGTTC
TCTCGCCAAGTTCAAGACGTGGCAGGAACTGGTGTTCGTGACGCTGTCGCAGCGTGTCCTGGCCGAGCCGCTGTACGTGCGTATGCACTACGGTCACCCG
GATGTGTTCGACAAGGTGCTGGCGATCACGCGCGGTGGTGTGTCGAAGGCCAGTAAGGGCATCAACCTGTCGGAGGATGTGTTCGCTGGTTTCAATACGA
CGCTGCGCGGCGGCGTCGTGACCCACGTGGAGTTCATGCAGTGTGGTAAGGGTCGTGATGTGGCTCTGTCGCAGATCTCGATGTTTGAGGGCAAGCTGGC
CAACGGTGCCGGTGAGACTTCGCTGGCTCGTGAGGCGCATCGCATGGGCCAGTTCATGGATTTCTTCCGTCTGAACTCGATGTACTACTCGCACACGGGC
TTCTACTACGCGACGTGGATGACGATTGTCACGACGTTCGTGTACATGTACTGCAAGGTCTACATCGCCCTGTCCGGCGTGCAGACGCAGATTGTGTACA
ACATGAACACGACGGAGATCATCATGGACAACTCGGAGACCTACGGCTTCGACGACCGCGTGTACCACGACATGGACTCGGTGTACAACACGCAGTATTA
CATCCAGGCTGGTCTGTTCCTGTCGCTGCCGCTGATTTGTGTGTACTTCGCTGAAATGGGTCTGCGTCGCGGTCTGGTGCAGTTCTTGGAGATGGTGTTC
ACGGCTGGCCCAGCGTTCTTCATCTTCCAGCTGGGTACGACCATGCACTTTTTCGACAACAACCTTCTGCACGGTGAGGCTCAGTACAAGGCTACGGGTC
GTGGCTTCAAGATCACTCGTGAGACGTTCGTGCTGCTGTACAAGGCTTACGCCCTGAGTCACTACCGCAAGGCCATGGAGCTCATCGGTCTGTGTTTGGT
GTACCTGACGTTCGGCAAGTTCGACATCTGTGACACCTCTGTTGCTGGTGAGGAGAACTCGTTCGCGTTTGACTACTGTGAGACGTCGCAGAGCTTTGGT
GTGCAGACGTTCGCTATTTGGGTTATTGCTATCGTGTGGCTGGTGTCTCCATACATTTTCAACACGGACGGACTTGACTGGGAGAAGACCAAGGCCGATG
TGACGGCCTGGGCCAAGTGGATGTACGCCGCTGAGGACTACAAGGACGAGGACAAGGTCATGGTCGGTGGATGGATCGCGTGGTGGAAGGGCGAGCTCAG
CTTGTACCATAACACGAAGCCCGTCGCCCGATTCACGGTCATTCTGCGTGAAGCTCGCCACTTCCTGCTCATGTGGTACGTGGTGGCGCTCGAGTGGGAA
ATCCTCTCGGTTGGCCTGGTGTTCGGTGCTGCTGTGGTCACGGTGCTCGCTATGGGCCTCTTCGGTGCCGCGGGCAGCTGCTTCCGCAACGTGAACTCAT
CGATCCGTGCTGTCATGTACCTGTTCGTGGTACTGGTGGCCCTTATTGTGTTCTTTGTGGCCACTATCGTGATCTCGGACGTCAGCTTCACCCGTACCCT
CTCGCTGTTCTTCGGCTACATGGCGGCTCTGTACGGCATCAACGAGATGGCTCGCATGTACAGCTTTGCCAACTCGTCGATCGCGTCCGTGGGCATGTTC
CAGCAGCTGGCCTTCTTCTTCGACTTCATCTTCTCGGTGGCTATGATCGTGCCGCTCCTCGTGATGTCTGCGATCCCGTTCCTGAA