Description :
From Genome Similarity Track
Location :
Scaffold_16:354148- 355860
Transcript NameFunction/comments
g18150.t1RAW42259.1 hypothetical protein PC110_g1595 [Phytophthora cactorum
g18151.t1XP_008892981.1 hypothetical protein PPTG_01427 [Phytophthora parasitica INRA-310

Sequence
1712 bases(100 bases per row)
TACGATCTCCAATGCAGCACTTCCTTAGTGCAGTCAGGAGGAGGTTCTTCCTACCCTTCGGAGTGATGCGAACCATCAGCAAGAACACAAAAAGCGCCAC
GGAGATGCAGAAAGGAACAAGTTTCACCTAGGGATGCACAAAGAAGGCCAACATTCAGTACAGAAGCTTCCCTGTAATACCAAAATGCGAAAGTGACTTA
CTTTGCGAAGCAGCGAATTCTGGTCGCCCTGCATTCGGCGCATTCGGCGTTCCATGTTCCCGGCCTCCAATTTGTCCCTACCAAACAGTTCCATTTCGCG
TTGTCAATATAACTCCTTTAATCCAGCCAACATGATATTCTGCATACTTCGAGGTAAGTCCAAACACGCGACCCAGGAGATCATCAATGTCACCCGACGA
GTAAAAGCGCTCATTGGACAGCCGTTGCATGAACGCCTCCTGCGTGCACGACTTGATCGTCTTGTCGAACTGCACCAGCCAACCAACCAGCCATCAGCTA
CCGACACCGCCTCAAAATCTTAAAATTCAGCGCACCTTCTTGACAATCTTACGGAAGCCCGAGTGATTGATCTGCACGAACGTGCGCAGATCGACGAGCG
TGTCGTAAATCTCCTGCAGCGCCGCAAACCCGTGGTCGGCTACAGCAGCAACAACCAAAAGAAGAATCAGCATCTCATCCCCCTCAAATCTCGCGAGAAG
AGGACGGCCAACAACTTACCCTGCGAGTGGGTCCTGGAGCGTGTGTGCACGTGTCCAGTGGCCGTCTGCTCATCCGCTAGCATGGCCTCGAACTCCCCCA
CCGAGTGCTGCAGCGTCACGACCTTGCCCACGTAGAAGTCGTTGACGATCTTGAGGTTGGCGTCCAGCACCTCCCAAAACTGATCCTTGGCGTCCTGCAC
CTCGTCCACTACAGCCTTGAGCAGTGGGTGCGTCTCGTCCACCACCTGCAGCTGCACGTCGCCCGTGGCGCTGTGGTCCATTTTCTGCTGCAGCTTCTGT
TGTTTGTTCTGCTTCTTCTCCAGCTCGAACGCCACGCGCTTGATGAGCCTCTTGAGCCGCTTGTACTGCACATAGTTATCGCGCCACTCCGGGTTCGCCG
AGATCTCCAGCTGCTTACCGAACTTCATGGCTGCCTCAAGCGGGGTGGCTGCAGTGCTGCTGGCCGGGCGGTTTGGCTAATGGCTCAGCAAATGAGACGG
CGGGAAGTAAAACGGGCGTTGAAGCGCATGATCAGCAACTTAAATTAGTTGAAGCAACTTAGTATATGCTGTCGAGCTTTCGCCTGCTGCGAGTGGTGGG
TTTCCGCCATCCAAAAAGGAGCGTGTTTTGTCCAGCGCCGACTAACGTGCGTACAACGAGATTCGCGCTGCTATCGTTGCTGCATCTAGCGGGCGGCGTA
GATACTCAGACTAAGTTGCCCGTGGTGCGTCCAGAAGCTAAAGTTGTACATAGTGGTGTGGCGCACACCAAGAATTGGTGAGACACTCACCTCGGCCATT
TTGACCACAGCAGCCATGGCGTTCCGACGCGACGTGATGCCGCTGGACAAGATGGTGCTCAAGTTCATCGCCAAGGCGCCGCGGCAGCTGGGCGTGATCC
TCAACGAGAAGACGCTGGAGCGTGCGCACCGCATCGGGAAGCCGGCCAAGTCGCGCACGCACAGGGCCAAGCAGGAGGTCATCCGAGCGCTGCTGCGTGG
TGGGCGCCTGGG