Description :
From Genome Similarity Track
Location :
contig_99:35414- 42343
Transcript NameFunction/comments
g13402.t1hypothetical protein

Sequence
6929 bases(100 bases per row)
CCGAGAATGGGGCCGGACGCGGCGGCATGAGCTGTGGTTACGCTGTTGGCGGCGGCACGAGGTGTAGTTACTCTATAGACGGCGGCACGACCGAGAATTG
GGTCGGACGCGGCGGCATGAGCTGTAGTTACGCTGTTGGCGGCGGCACGACTGAGAATTGGGCCGGACGCGGCGGCACGAGGTGTAGTTACGCTGTTGGC
GGCGGCACGACCGAGAATGGGGCCGGACGCGGCGGCATGAGCTGTGGTTACGCTGTTGGCGGCGGCATGAGGTGTAGTTACTCTATAGACGGCGGCACGA
CCGAGAATGGGGCCGGACGCGGCGGCATGAGCTGTGGTTACGTGTGACGCAGTTGCCGTCAGCGGCAGGTATTGCCGCAACTACAACCAATCTGGTTGAA
CAATAAATTTTCGTATGCATGTCTACCAATATCTGAATGGCGCAAGATATTCAAGGATAAGAACAAGAATCTGATACGTCCGATAATCATTAATTTGATT
GGTCTAAATCATCAAGATTTGATAATATCCAGTATGGGAACTGGATTTTTGATGAAACTACAACTACGTGGATATTTTAGACAAGATCATTGGTAGAACA
GATAGCAGCTGAGATTAGAGAAGGATAGGCTTTAGGGTAGGACACTAGTGGTCTCAAGGACATCCGTAAAAGCAAACAGCTCAATCTCAATCACTTCTCA
ATTTGCTTTCAATAGCAACAACCCCTCCACCAACCTCGTCACCTGCCTACCCAAGGACCGCACGCCGGACACGCCAAGCAAGACCTTCCTCGGCGCAAGA
CTGTTACATAGTAGCACTTGCCGTGTCAAGCTTCGATTCAAGCTTCGGTTCAAGTTCAAGAGTTCAAGGCTAGGGTACTTGTGGCCACATAGTGGGAAGC
GAGTATCCTGTGACTATTAGTGCGAGCCACATCGTGGGGAGCACTAGGTTGCGAAAGGGTTGTCTTTTAGCACGAACGTTACGTTCAGTGGCTAGTCGGT
GTGGTTGTGAACCAGTGTGGTTACTCGATTGGTACTCCTTCTGTGGGTCCGCGGTTTAGTGCTTTCACTTTGTGAATCCCTGTCCCGCCTCAGAAAACAC
GGAGAATAACTTCCTTTCGGTATACCTACTTGGTCTTACTTGATCTACATCCATTGCTACTGCAACTGTTTCAGTGTGCATTGTTGCATGGGTAAACGAA
AAACTCGCGAGCCCGAAGAACCGTTCGTCAACACCACTAAGGTCTTAACCGATCGCCATAAGGAGCTTGATAAGCTTCGAAAGGACCTGTGGTTAACGAC
GGTAAAGCAACTTAAGGTTGTCAAACTCATCCGAAACGAAATTCCGGATTGTAAAAATTCAAGTGCGAGGAACGTCGTTCACGAATTTTCGGAACAGCTG
AAACAGCTTATCGAGCGTACCCAAACGGTTTTGGAAGGAACATTCGACCACTCCGTCCAACTTTACAAGAAACGTAGACTGTAAATAAGAATTTAGACAG
TTCCGTTTTATTTTCAAAGGCTTTATTTTAGGGTTTCGGTAGTATATATAGTGACGGCGCTGAGAAGTCCGGTTGATATGACCCAAAGAAGAGGTCGTGC
AACTGAGCGCCCGTCCCCGAACCCTAGACCTCGTCAACAGAGCAGAATGAGCTCTCCGAGTGACAATGAAGCCACACGCCCGACAACACGTTCCAGAACA
CGCACGCAAGCACAACCGAATGGGGCTAGTGCCGATAATGAGGCAAATTCGGCCGCCCCCGCTGCAGCAGCTGCGCAATCAAGTCATGGACCCGATACGA
TGTCCATGCAGCAGTTACTAGTGTATCTTACACAGCAGCAACAACAATATCAAGCCCAGGTGCAAGCCCAAATGCAAGCCCAAATGCAGCAGGCTAACGA
GCGTTTTGAATTCCTCGTTGCATCAAGAGGCGAACACAAGAAGAAGGACCCTCCTGTGTATGAAGGGAAGTACGGCGAAGACATTGAGCTATGGATCTTC
GCTACTGAACAGTACTATGCCAACAAGCGTCACATAATGGAAGCTGATTCGTCAGACTTTGTGACGCTAATCTCCAGTAACTTGGGCAAGTCCGTGTTGA
ATTGGTACCGTGCCTTTATCACGGATTGTGAGCGCATGAGCGTTCACCAAACATGGTCTCTGTTCAAGCGTCAACTGCGTACACGTTTCCGACCCAAGGA
CTTCGAGTATGATCTTCGCGAGCGGATGTTTCACTTAAAACAAAAGGAAACAATCCACGAATATGTCTCTAAGTTCCAAGACTTGTTGTCTCAAACTGAA
TTAGAGATAAGTGAACTAGAGAAGCGTTTCTTTTTCCAGAATGGACTACGGGAAGAAACCGCGAAGAAAATCAAAGAAGAAAGTCCGAGTACGCTTCAAG
ACGCTATGGAGATTGCCTCTAACTTCGAGTTTGCACATTACTCGGGTAAACCACCTCGCATTCCGTCCAAGTCATCGCAGGCACCGGCCGAATCCGGTAA
ACGTTCAATCAAGCCGACATCGCAGAAACCAAAGCGATTCGAGAAGAAGAAGAACAAGAATGATGACTGGACGAAAACAGCTACATGCAATAACTGTGGC
AAAGTTGGCCACATTTCCCCGCAATGTACCGCTCCAAAACGTAAGGAAGCAAATAGGTACATCAGCGGCGCACTGTATGCTATCTTGGAAGCCGAGGCTC
ATGCGTACAAAGAAACGGGTCAAGAGAGATCCGTCACCATTTTCATTGATAATGGATGCAGCTTAAATGGCGTATCTGAGGAATTGGTGAAAACGCTTGG
GCTGGAGGTAACCGAAGGCGAGTTGATGCAGGTCGACCTTGGTTATGACCAAGTGGTACACCGTCCGCGTCGAACCGTGGAGATGAGTCTGCAGCTACCA
GGTTTCCCATTGACGTCGGGAACCTTCCAAGTCATGCCCGTTCCAGAAAACAAGGATGTTATTCTGGGCATGATGTGGCTGCGAGAGCAAAACCCGGATA
TCGACTGGAGTACAGGGCAGGTCACACCACGCATCAAGATGGAGGATGAGCAAGATGCTCAACTAAGACTGCCTAAGCAACGCCCAGCTAGAAGAGTCGC
TGGACAACGCAGATCTCGTATCGACCAAAGTCGCGAGATTTTCAACCACTATCGGCAGCATGGCCACAAAGGCCAATATGGCAAGACGCGACTTATTTCA
GCTCAACAATTTCTAAGAATGTTGCGTCATGACAAGGACATTGAAGCAATCTTTGTCATCAATCCGCATGACTCTGAGAAGGCAGAACGCTTTAAGAGTC
AAGGATGGGAGGCACTTAAGGATAATCCAGCGTATGATATACTACGCAAGTATGCGGATACTGTTTTTCGCACGGAACTTCCAAACGAGACGCCTCCTGT
ACGAGAAGGGATCGAACACGAAATCCTTCTCCAGCCTGGTACCACGCCTATTTCGGTGAAACAATGGCGCCAGAGCCCTGATCAGCGCATCACAATTCAA
GATTGGACCAAAGAGATGGTTCAAGCGGGCATTATTCGACCAAGCACGTCTGCATTTTCCGCGCCGACGTTCTGTGTCAAGAAGCCTGTTGGATGGCGCA
TTGTGCACGACTATCGTCAGCTAAATCTAGCGACAATTTTGCCGGCTATACCAATGCCGCGCAAGGAGGATACCTTTGATGCCATGGCGGGCAGTCATTG
GTTTTCGTGCATGGACCTACTGTGGGGTTACTACCAAGTTAAGCTACGTGAATCGGACATACCGTTTACAGCTTTTTCGACCCCTGATGGTCTATTTGAA
TACCTCGTTACTCCAATGGGACTCAGTGGTAGTCCCGGAACATTTAACCGTCTTTTACAGAAAGTCTTTAGGGACTTAAGAGACGTGATGAGGATCTATT
TTGACGACATCTACGTATTCACCCCGAGCGAAGATGTCGCAGAGCACCTTGAAGCTTTAGATCGTGTGCTCAAGCGATGTGAAGAACAGCAACTTTACAT
CAAATTATCCAAGTGTCAGTTCTGTGTGGACGAGATTCCATGCCTAGGAGATTTCGTCGGACGAAAAGGAGTCCGAATGGATCCAGACAAGGTTCGCATC
ATCGCAGAATGGCCTGTTCCCAAGACCAAGAAGCAAATGGAGAGCTTCTTAGGAACTACGGTCTATGTGTCCAGATTCTGTAAGGACTTTGCACAATTTG
CAGGACCACTTCATGACAGCATCAAGGGAAAGCGTCCACGAGAGACTATTGAACTCTCGGACGATCAACTCAAGTGCTTCAAAGAGCTTAAACGCCGGTT
AGCCTCACCACCAGTTCTCGGCCTTCCTGACTTCACAAAACCTTTTGGTATTCGCATGGACGCCTCGAATTTTGCAATCGGGGGAGTCTTGTTTCAAAAG
GAGGGAGGGCTAGAGCATCCAATCGCGTATACTGGCCGGAAGATGAAGCCAGCAGAACTAAACTACCCTGTTCGAGAACAGGAGTTGCTCGCGATCATGC
ATGCTCTTCGAGTATGGCGTGTGTATCTTCTTGACCGACCGTTTACGGTCGAAACGGATCACAAAAGTATTGAGATGATTCTGACTCAGAAGACTACAAA
CCGACGCGTTGCACGATGGTTCAATGAGCTTGCTGAATTCCAGCCTTTGTTCAAGTGGATTCCCGGAGAAACGAATACCGTGGCTGATGCATTGTCACGA
AATCCAGAGTTTGAACTGAAAGCTGCTCAAGTAAGCTTACAAGAGCTACTGGAAGCAGCCAAGAATCGTGAAATTGTGGCAACGATTGTACCAAACAAGG
TGACAGTGGCCCAAACGGCGAAGTCGATGTATTCGTGGAACAAGGATCTACAGTGGATCATCAAGAAGCTGAAGCAAGGGGATGAATTGCCTAAATACTC
CTTACAGGATGACATTCTTTTCTATCAAACTGCGGAAGACCAGACTCCACGATTGTACATCCCTGATGACGAAGATCTGAAGAATCGAGTCATTTGCGAG
AATCACGATGCAGTAGCAGCAGGACACCCAGGGTTTTATAAGACCTATTTGGCAGTACGCGAGAAATACTACTGGCCGAAGATGATGAAGTACATCCAGC
GCTATGTCAACACATGTGAAATGTGTCAGCGCAACAAGGCGAGACAAACCAAGCCGCCGGGACTACTTCAACCACTAGACATACCTTCGGGTAGGTGGAC
AGACATCTCAATGGATTTTGTAGTGTCACTGCCTGTCAGCACCAAAGGTTGCGATGCGATTATGGTAATCGTTGACCGGCTGACAAAGCGAGCGAAGTTC
GTTGCGACGAAGACAACGGACAACACCACAGATATCGCTAACGTGTTCATGAAGAATTATGTAAAGGATCACGGTTTACCCAAAACCATTATATCCGATC
GAGACACCAAGTTTACGTCCAAACTTTGGCAGAGTATTGTGAGTGCGCTTGGTACGCAGCACAACTTGTCATCGGCTTTCCGACCCCAAACAGATGGACA
AACGGAACGGACAAATCGATTTATCGGAGATTATCTTCGAGGTGTCGTCAACCCAGCTCAAAATGACTGGGATGAATATCTCCATTTGGCAGAAATTGCC
TACAACCGACGTGTACACTCCACGATTCGAATGTCGCCGTTCGAAGCGGATCTAGGATATGTCCCCTACATGCCAGACGATGTGGCATCAGATCCGGAGT
TTAAGAAATTGGAGAAAACAGCGCAAGAGTTTTTACTTCAGCAAGAGACTCTACTCAAGGTCGCACAAGACCGTATGAGCGAGGCGCAGGAGCGTATGAA
GTATTATTACGACAAGAATAGACTTGTCCAGAACTTCGAAGTCAACGACATGGTGCTTTTAGACGGAAAGAATTTGGATATCCGTCACAAGGGGTATGCC
CAGTCGAAGAAACTCGCTCCACGATACATTGGACCTTTTCCAGTGATAAAGAAGATCTCAAAAGATTCCTATGAGTTGGGATTATCGAAGGGATTAAAGT
TGCATCCTGTGTTCCACACATCATTGCTGAAACCGTATCGCAAGGACCCAAAGCGAAGGCAGCAGGTGAACAAAGTCGTGTTAGCCGATGGAACCGAAGG
ACAACTCGTTGAAGCGGTGATTGATCACCGCATGTACAAGGGAAAACCGCAGTACAAGATTTGGTGGCTAGGTGAATTCAGAGCTGATGCAACCTGGGAA
CCCATTGAGAATCTAAAGCAGATTCCTGGGCTCATCGACCTCTATTGGAAATCCAAGAAGCGACCGAAGCCATTTTCAAAATAGGCGTCTTCTTGAAGGG
AGGTCATGTGACGCAGTTGCCGTCAGCGGCAGGTATTGCCGCAACTACAACCAATCTGGTTGAACAATAAATTTTCGTATGCATGTCTACCAATATCTGA
ATGGCGCAAGATATTCAAGGATAAGAACAAGAATCTGATACGTCCGATAATCATTAATTTGATTGGTCTAAATCATCAAGATTTGATAATATCCAGTATG
GGAACTGGATTTTTGATGAAACTACAACTACGTGGATATTTTAGACAAGATCATTGGTAGAACAGATAGCAGCTGAGATTAGAGAAGGATAGGCTTTAGG
GTAGGACACTAGTGGTCTCAAGGACATCCGTAAAAGCAAACAGCTCAATCTCAATCACTTCTCAATTTGCTTTCAATAGCAACAACCCCTCCACCAACCT
CGTCACCTGCCTACCCAAGGACCGCACGCCGGACACGCCAAGCAAGACCTTCCTCGGCGCAAGACTGTTACATTACGCTGTTGGCGGCGGCATGAGGTGT
GGTTGAGGTTGGTGTCAGGCCACCAAAGCTTTGGAATCGACCACCGTGTTGTGCCCACTCACAAGCAGTGATGTGGGCACATAAAAAACAGAAAGGAATG
CCCACACATTGCGGAGTGCAGACGCACCC