Description :
From Genome Similarity Track
Location :
scaffold_700:3541- 8334
Transcript NameFunction/comments
g9923.t1hypothetical protein
g9924.t1hypothetical protein

Sequence
4793 bases(100 bases per row)
TCGCTACGCTCCCGAGCTGATCACCCGGGTCAACATAAAGAAGTTGTACGCCACGGCACCTTGGGACGTGTTAGTCGCTCGGGCTCCTGCGCCTCTCTCC
TTCCAGCCGTCGCGATCTCCTGATCTTGCCGCGATCTTGAGCTGGTACGAGGCGTTCGAGGCCACGCACATTCAGGCGATCTGGGAGTGCACACACTCCT
TCCCGATCACCAACGAGATGAAGAAGTCGGATCCCTGGTTCGCCAACTTCGTAAGAATCGTGGATCTCACGCTGGCGAGAAGTACCGAGTTCTACAGGAG
CGGGTTTTCCAGCGGATGCGTCAGACTGGATGCTGTGATATCGATCTTTGGCTGGATCCTCGATTCGTGCAGTTCCCCGTGTCGACGGAAGACACGACGT
GGTTTCCCGGCCGCGAAGCTGCCACCGCTGGGCTGGATCCTCCGCAAGATCTCTCGGACGCGTTGGACGACTGCGATCGCGTGGACGCTTGGCGAAGCCA
CTTTCGTTTCGAGCCACGTCTCCATCCGAGCCTTGGTATCAATCGACTAGGACTCAAGTTCACGCCGCTACCGTAGGACGAGTAGCTTCCGCCGATAGCT
TCTGCATATCGTAACTTCCAATTCCACTCTTATTCTTTTCATGATCACTCTTGTCCATGTTCGATAGATCCAGCTCAGGATCCGGCTTCATTCATCCCAA
CCCCACTTGTTTGTAATTTTTGAAAATATAAACACACATCCACCCGACAACCAAGTTGTCGGATGGCAAACCACTGTCACTTGACTTGCATCATCCTGCA
GATCCCTAGTTCACTAGCCACACCATCGGCCGCCCCGAAGGTGTGATCCACCACCTCACTCTTCCTCATGCGACCGCATCGCCTGGAACCGGTTCCGCTT
GCTTCGGCCCTGGAGAAACACGTACAACAGCGCTCCGCAGTTCAGATCAACTTCGTCGACCCAGGTGGGATCCTCGTATCCCTTCCAGGACACTTGGAAC
TCTCGCCGGATCCCACCATATCGCGTCGGTCGTCCGGTCCGCACGTCCACGATCCGTTCGACCTCGAATTCATCGTCTTCCAGTTCACGATCCCAGCTGT
CCTCGGGCAAAAGCGCCTCGTCAAAGTCCAGGCGGTCCGCTTCATCGACTGTCAGTCGGATCCCAGATCGATCGGGAAAGATACTGACCGGTCTTTAGCT
TAGAGATGTGCACCACGGGGAAGAGGTGGTAATCCGTTCCCGCTACTTCCAATCGCACCGCGTACTCGCTCACCATCTCCGCAACACGGAATGGACCGTG
CCAGCTTCTTCGCGTATCCTTCCTTGACCCTGTCTAGGAAGAGCCACACTTGGGATCCGACCTCGATAGTGTGCAGCGTCGCCACCTCGTTGTTACGGTC
GGCGCGATCCGCAATGGCATGCTTCAACCGGTCGTTCGCCTCTGCTCGTGCTTGCTGGTAGTGCCGTTGGATCCGATATCTCCACCGACGTGGGTCCACA
TCGCGATGTCCGGTATTCCCCAAAGACAGCGTAGCCTCCAGCGTAGTCTTGGGATCCCATCTGTGAGCCAGGTAGAAGGGCGTGTCGCCCCTGGTCCTAT
CTTGCGCAGTATTCAGTGCGAATGTGAAGCGTTCAGCGTACTCATCCCAATCTCTCTGGTCGGGATCCTGGACATAAATTTTGATGGCTCGCGTGATCGT
CTGTACCATGCGCTCAGCTGATCCGTTCGACTGGGGTCGGTAGGCCATGGTCGCCCTTTGGCGCTGGCCCAGGATCCTGTTGAATGCGCGAAAGAAGTCG
GACATAAACCCTGGCTCGCGATCGTGTCGGATCACCTAGCTGGCTCCGAAGCGTCGGAACACGCAGGCTTCATACGATTCAGCAACCGCTTGGGCCGTCC
TCGAGTCGTTGGCGCTTGCGATCACGTACCCGGTAAAGAGATCCACCCACACGAGAAGCTCAGTGTTCCCCTTCATCGACTTAGGTAGCGAAGGGATATG
GTCCATGGCTATGACTTGGAAAGGGTAGGTGGCTTGAATGTTGCCTGGCGACACTCCTCTAATAGTTGGTCGCCCCTTGCCCGTCTCGCAGTCAACGCAT
TCACCGATGAACTTCTGCACAGATCTGAAGAGTCCTCTCCAGTAGAAGTGATCCTTGATCCTCTGGTAAGTACGTTCGATCCCCTGGTGGCCACCTTCCA
AGCTCACATCGTAGTGATGTAACAGGTCCGCTTGCAGCGTCTCCGAACCCACCAGGCGCAGCAATCCGTCGCGATCCGCGTCCGCTTTGCTGGAGGGGGG
GGGCAGTAGAGCAGCAGCTCGGAGTCGTCCAGCTCGAAGTTGTCCGCAAGCAAGCGGCAAGCCTTGGCTTCCGCACCGCTAAGGTCTGTTAACTGGCCTC
TTAGAGACACTTTCAGGTTGGCGATCCATACCTCCTCGTCCTGCGCCTGCTGGACCCGCTCGATTCGCAACCGATGGACAGCTTCTTCGTCTAGCACTTT
GGGCCGTCCTTCTCTGGCTTGCCTCCTGGTCGTGACTGCATGGATCTTCGCCACGGATCCTTCGGATCCTGGGATCAGGATCTCATCCAGCCTGTTCAGA
GTGACCTGATCTTCCAAGTCCGACTCCGCTTCGACCACGATTCCACTCTCCCGTTGGAGCGCCGTGCTAGCTAGGCTGTCGGCACTGGCGTTCCACGCTC
TCTTGACATGCAGTAGGCCATGATCCGGCCATGTCCGCAGCTTAGTCAACGCCCTCTGTCGCAGCAGCATCAGCGCCGGCGCTTTGCAATCGATCTCTAT
ACGCATCTGTCAGATCACCAGGTTGGAGTCCCGACAGATGTTGAGGCGTTCCTTGGTAAGATCCTCCAGCAACTCGAAACATAGCAGGAGTCCATTGTAC
TCGGCCTCATTAACTGTCATAGTCTCTGCGTAACCTGATGCAGCCTTCACCACAGTCCACTCAGGTAACCTCCAGACAACCGCACTATACGCGCCTCCGC
CTCGCTTGACTCGGGCGGATCCATCGAAACTGGCAACCAGTAGCTCCTCGTCGGACCGTACGGTCCGCACAGGCATCTGGATCGTTCGTCGTGGTTCCCT
CCGGGGAGCAATATTGACTAGCGCCTTGTCTACCTCGGATCGGGGCGTAATACTCGCCGCGAGCGTCCCCAGGATCTCGTCCTCGCCCTTCGTACACTTA
GTGATCTCTAGAGTCCAGGGCGACAGCAGCGCAGCCCACTGTCCCAAGCGTCCTTGCAATCCCGAAGAGCGGAACAGCCACGCCAGGGTGGAGTGTCGAG
TTAGGATCCGGATATGTCTGCCCACTAACATAGAATAGCCGAGATCCAACATCCGCAATAGAGCCAACACCTTCTCCACGATCCCATAATTCAACTCGTT
CTGGTTCAAGGATCGACTTACGAACATAACCGGCAGGTAAACACCCTCGTGATCCTGCGTCAGCGACGCCGATATAGCCCACTCGCTAGCGTACAACACA
ATCACCGGATCCTTCGCGGGGTCGAAGTGACGGAGCGTCGGCGTCGTCGCGATCTTACTCTTGAGTGCGGTGAACGCAGCTGTAGCTCGGATCCACTTGT
CATGCCCGTCTTCCGGATCCTCGTTCGCCAGGATCCTATCCTTGGATCTCAACTCCGCGAAGTCCACCTCGCGCAATTCGTACAGCACCGACGCATAGAT
CGCCATGTCTTCAATGAATCTAGCGTAGTAGTCCAGGCTGCCCAAAAACGACTGCATCGCTCGCAATGATCTCAGGAAAGGTAGATCCACCAGGGCCTGC
AGATCTTTCGGGTGTGCCTCCAGGCCTTTGTAAGAGACTCGATGGCCGAGATACTCCACCTTCCGTAGGCCCCAGAAACTCTTCGCCACGCTGATAGACA
GGTTCCACTTGTCGCGCGCTTCCAGCAGCTGATGCACTCGCTCACACAAGTGATCCCAGGATCCCGCAGTAACCAGGATGTCATCGATATAGGATCGGCG
CCCCAAGACTGAGGACTGACCACTAACCTCAGGAATCCCTTCGATGAAGAGATCTGCCACGGATCCTGGCTCGGAAGCAGGTGGGATCGGCAAGAAGCCA
TAGAGAACATTGTCTAGCAGCCGCTGGTAGATCTGCGGAGCTTTCTTCAGCCCGAAGGGCATGCGGTTCCACTCGAAAAGATCAAACGGAGTGATGAAAG
CTGAGATCGCTCGCGCGCGGTCCGTCATAGTCACCACTCACCATATCCAAGGAACAGTACCACAAGATCGCGTCGAGATCCTCTAACAAGTCTTTGATCA
ACGGCATAGGGTAGATCATCAATCGTGTTAGGCTGTTGACCAACCTGTAATCAATACACAGTCTGATGTCCACGCCATTTTTCTTGATGATCACCACGAT
GGGCGACGCCCACGGTGACGTAGATACTTGGATGATCTTGGCCTGCAGCAATCCTTTGATAAGATCCGAGAACTTCTCGCGATACTGGGGCGGCACCTTG
CGCACTCGCTGGGCGATTGGCTTCGCGTCGCCGACGTCGATGTCGCACACCGCCCCAACCGCTGCGGGGGGCAGGGCATTGCCCATGCCGATCAGCAGGT
GCTAGTACTTCCAGATCTCTTCCGCCAGTCGCTGGATCTCCCCCGGAGTGTTGGTCGCCGGATCTCCCACTTGCAAGTCTTCGATCTTCACCTCGATCGT
CGTGGCCGTAACCTCGGGCAACACTGCCAACTCCTTCTCGAGATCTTCTGCGTGTAGATCGCCACTCTCGTGCAGATACACTGCGTCGTCCTC