Description :
From Genome Similarity Track
Location :
Scaffold_556:3541- 6221
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_556-fgenesh-gene-0.2Apicomplexan specific region near N-terminus
Pytve_DAOMBR484maker-pve_contig_556-fgenesh-gene-0.3Serine/threonine protein kinase

Sequence
2680 bases(100 bases per row)
CGACGTGGTCGGCACAGGGTCGGCGAGCTGTTAGCAGCAAGATGTCCATGCGATAGTGAGCGAGAGGTCTCCGTGCAAACACGCGCGACGGAGCCACTCA
CCAGGCCGACGAGGTCGTCGTTGAAGGCCTTGGCAGGCGCCGGCTGCTCCTCTCGCTTGGCTGAAAGTACACAGCATCAACGGGTCAATCGCAGGTCGAC
TGGTAAGCAGCAGCGATCTCCAGCACGCACCGGACGGCGTCGGCGGCAGCGACGTCTCAATGAGGTCCGGCGCCTTCACGGGCTGCGGCTTGGCCGCCGC
GGGTTGTTTGGCCGCCGCGGGAGTGGCACTGGCGCGCTGCACGCGCGAGATCTTGCTGATGACGAGTCCGTTGTAGTCGGGCACGGCGTCCGCGTCGTTG
ACCACGTCGAGCCATACTGCCGATCCTCCAGGTCAGAGCATTCCACGATGGTGGTCACAGGGGAAGACAATCGACCGCTTCACTCACCGTACGTGCCCTC
GAACGCCGTCTTGAAGCGGAAGTGGAAGTCGCCAGGCAGGGGGAAGCACTACGTGTAGCAACAGCAGCAACAGCAGCCTAGTTGGAGTGGATGCCTGACC
AAGGGAGCCGAAAGCAGACCGCACCTTCTTGACATGCTGCAGCCGCAGCTGGTCCACGCGCGGCAGCGGCACCACGTTCAGGTGGTCGGACGAATCGCCG
TCCTCCGGCACAAAGTAGTTGAGCATGCCCTCCATCGCGCCGCGGGTACTGAGCCTCGCTCGCCTCTCGCCGCCGACCTGCCTCGCTCCGAGCCGAACGG
CCGCCTTGGTCAAATTCGGGCAGGGGAAGCTGCTCGAAGTGTCCCAAGATAGAGTTTGTAACCTCAGGTGGTCGTCCTCATATAGGGTGGATGTGCCTTG
TTTAGGCTGATTTTGAGACTCGATGTACCTTAAACCAGTGGATATCCTTGTCATTGTGGCGACTTTGGCTGCTGATCTCGACATGGACACCAAGCAGGTC
AACACGGACGCGCTGGCGGCCGCCATGGCCGAGCGGGAGGCGTCTCGCGCTGCTGCCGCCGAGCACTCGGAGGACCAGCGCATGGACCAGGCCGAGGCGG
AGGAGGAGCGCCGCGTCGTCAAGCTGAGCGAATGCGTGGAGCTGGACCGCGACGCCGAGGTATCTCCTTCCTCTGTCCATTTCCAACAGTCCTGCGCTAT
CCATTGCTTACACATTGTATGCTGCTCCTTAGGACGTCTACTACGTCGGGACGTCCGGACTGAAGATCACCGAGCTCGACGGCCTCGAGAACTTGCCGCG
CCTGCAGGTACGGCATCAATGTATCCCTCTTCGCATCCATTGCATTGGTGGGAACTAACCAGACGAAATGACGCAGAGCCTGCACGTGCGGTCGAACCTG
CTGACCTCCATGCGCGGCGTCGAGTCGCTGGCAGCGCTGGAGCAGCTCGAGCTGTACGACAACGAGGTGGAGGCCATCTCGGGGCTCGAGACGCTCACCA
ACCTGCGCGTGCTCGACCTGTCGTTCAACCACATCCGCCACGTCCCGGACCTGCGCCACCTCGCGCGGCTCGAGGAGCTCTACGTGGCCAACAACAAGCT
CAAGAAGATCTCGGGCGTCGCGGGGCTCGCTGGCCTCAAGAAGCTCGACCTCGGCGCCAACCGCATCCGGACGATCGAGGGGCTGGACGGTCTGCCGAGT
CTCGAGCAGCTCTGGCTCGGCAAGAACAAGATCACCAAGGTGCAGGGCCTCGAGGCGCTGTCAAGCCTGAAGATTATCAGCGTCCAGGTATGGCGTCGTC
CCAATTGGTTCACGAGGGAATGGCATTGCTAACGCGGTGTGGTCGTCAGAGCAACCGACTGGTGACGATCGAGGGGCTCGAGCACAACCTCGCGCTCGAG
GAGCTCTACCTGAGCCACAACGGCATCGAGAAGCTCGAGAATGTCGAGCACTTGGTGCGTTCATTGACGTGTGGTGGACATGCGTGGTATTGATAGTACT
CATTTACCGTTCGTGTGTCTTTCAGGCCAACCTGACGGTGCTGGACGTCGGCGCGAACCGGATCGCGGCCATCCCGACGACGCTGCGGACGCTCGCGGCG
CTCGAAGACCTGTGGCTGAACGACAACCAGGTCGAGCGCTTCGCCGACGCCGAGCACCTCGTGCCGCTCGCAGGCCTGCGCACGCTCTACCTCGAGCGCA
ACCCGCTCGCGCGCGACTTTGAGTACCGCACCAGGCTCGAGGCGCTGCTGCCTGAGCTCGACCAGATCGACGCTGTGCCGACCAACAAGGCCCGGCGCGG
CCGCGGGTAGTCAGTCGCCCATCGGGTATTCCCCATATCGCGCAGACTAATGGAAACTGTTGACAGCGATCTCCCACTCGCATCGGAGCCATTTGCACCG
CGTCGCTCAGCCTTTGGTCGCTGTCACGACTCCGCCGCGCGGGTCGCCGTTGGTCACGTAGACCTTGGGCGGTGGAGCCCGCAGTCGGCAGCTCACGGCC
GAGCACACGACGCACAGCTCGCCGACGAAGACGACCCACGAACCGCAGTGTCTGCACCGCTGGCCGCGCAGTTTTCCCTTGTACACCGGCACGGCCAGCA
CCAATAGCATCAGCACGAGAACAGCGAACGTTGGTGCGACCCATGCCGTCGGCCTCGACTGCGCCGTCGGCACGGACCGC