Description :
From Genome Similarity Track
Location :
scaffold_190:3541- 5415
Sequence
1874 bases(100 bases per row)
GGCATCGACTACTGATGGAAGGTATGGATCTTGACACCGAAGCTTGACGGAGCGGAGGGAGGGGCAGCACTCTGGCGAGACCGGAGCGGAGACTGGAAAC
CACTTGAGGGGTAGAACGAAGATTCGAAAGTGATTGATTGAGGTCTTTAGCTCGCTAGCCTTCTCGCTACTCTAGACCTACTGGATACACACTACTTGAT
TCTTTACTGGATACTGAGTTACTTCAGCCAATGAGAGAGCGCCACGTCGAAGCCCATCTTGTACCTACAATCTTGTACCACAGGTGGCGTAATCGACAGT
GGCGTAATCGTCGGTGGCGTAATCGGCGTGGGTTCGGATTGGACCGGTTCGGGTTAACCGGTTCACGGTCAACAACCGATACCAAACCGGTAACCCTCAA
TAGGCTTCAAGCAGAAGTACGGCATCGACTACTGATGGAAGGTATGGATCTTGACACCGAAGCTTGACGGAGCGGAGGGAGGGGCAGCACTCTGGGCGAG
ACCGGAGCGGAGACTGGAAACCACTTGAGGGGTAGAACGAAGATTCGAAAGTGATTGATTGAGGTCTTTAGCTCGCTAGCCTTCTCGCTACTCTAGACCT
ACTGGATACACACTACTTGATTCTTTACTGGATACTGAGTTACTTCAGCCAATGAGAGAGCGCCACGTCGAAGCCCATCTTGTACCTACAATCTTGTACC
CACAGGTGGCGTAATCGACAGTGGCGTAATCGTCGGTGGCGTAATCGGCGTGGGTTCGGATTGGACCGGTTCGGGTTAACCGGTTCACGGTCAACAACCG
ATACCAAACCGGTAACCCTCAATAGGCTTCAAGCAGAAGTACGGCATCGACTACTGATGGAAGGTATGGATCTTGACACCGAAGCTTGACGGAGCGGAGG
GAGGGGCAGCACTCTGGGCGAGACCGGAGCGGAGACTGGAAACCACTTGAGGGGTAGAACGAAGATTCGAAAGTGATTGATTGAGGTCTTTAGCTCGCTA
GCCTTCTCGCTACTCTAGACCTACTGGATACACACTACTTGATTCTTTACTGGATACTGAGTTACTTCAGCCAATGAGAGAGCGCCACGTCGAAGCCCAT
CTTGTACCTACAATCTTGTACCCACAGGTGGCGTAATCGACAGTGGCGTAATCGTCGGTGGCGTAATCGGCGTGGGTTCGGATTGGACCGGTTCGGGTTA
ACCGGTTCACGGTCAACAACCGATACCAAACCGGTACCCTCAATAGGCTTCAAGCAGAAGTACGGCATCGACTACTGATGGAAGGTATGGATCTTGACAC
CGAAGCTTGACGGAGCGGAGGGAGGGGCAGCACTCTGGGCGAGACCGGAGCGGAGACTGGAAACCACTTGAGGGTAGAACGAAGATTCGAAAGTGATTGA
TTGAGGTCTTTAGCTCGCTAGCCTTCTCGCTACTCTAGACCTACTGGATACACACTACTTGATTCTTTACTGGATACTGAGTTACTTCAGCCAATGAGAG
AGCGCCACGTCGAAGCCCATCTTGTACCTACAATCTTGTACCCACAGGTGGCGTAATCGACAGTGGCGTAATCGTCGGTGGCGTAATCGGCGTGGGTTCG
GATTGGACCGGTTCGGGTTAACCGGTTCACGGTCAACAACCGATACCAAACCGGTAACCCTCAATAGGCTTCAAGCAGAAGTACGGCATCGACTACTGAT
GGAAGGTATGGATCTTGACACCGAAGCTTGACGGAGCGGAGGGAGGGCAGCACTCTGGGCGAGACCGGAGCGGAGACTGGAAACCACTTGAGGGGTAGAA
CGAAGATTCGAAAGTGATTGATTGAGGTCTTTAGCTCGCTAGCCTTCTCGCTACTCTAGACCTACTGGATACAC