Description :
From Genome Similarity Track
Location :
Scaffold_2329:354- 5164
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2329-snap-gene-0.1DnaJ (Hsp40) homolog, subfamily C, member 13

Sequence
4810 bases(100 bases per row)
GACGTCGGAGGCGTCCTGTCGACCTGCAGATTGTGCTGAGGATGGGTTGACACGAGCTTGTTGAGAGCCAATCGCATCACGACGATCGAACGTTCTCTCG
TAGGGTCGGCAGCTCCTCGCTACGCAGACACACCGAACACCCGTGTCAATCACACGAGATAAATCAGGCTGATCTTGTGGTTACGAACCTGCTGGAGAAT
GCGAAGGACATTCTCGCCGCTCTGGATGGAAATGAGCAATGCCTGCGAGAACGCCGACATGTCGATGTCCTCGAGCGACACGCCGTCTGACGACACGAAC
TTGTTGATGTACACATCGTGCACGATGAGTTCATCCATTAAGTCTGGATATTGATAACGGAACGAATCGGCAGCAATAAAGTGGTCCGGGTTCCACCGCG
GCCACACGTTAGACTTGGCGGCTGTCTTGACTTTGCCGAGTTCGACCGATAGCGTGTCGGCCAACCGTGCCTGCATGCTTGCAGTCCAGATCAATGTGGA
GCTGACAATGTCCTCCTTTGTTTGAAGTCGCAGCACGAATCGAGTGGGGGAGAGTCGTAAAATCTACAAAGTGAAACGAGAACGTCAACACCATCACAAA
GCACGCGCAGATGAGCCAAAGTCCAACATACCCGAACAAGACTTGGCGTGAGGAGTTGTTTCAAAACCTGCACAGGTGCAACCAGTTCGACACCTTCGCT
GTCGAACAGACACGACAATAAAGTCGTTGCGGCCGCTCGGACAGCAGCAGCCGCGGGAGGTAGCGACAATATGATCGCTCGCTGCTTTTCTTCTTCATCA
TCGGAGAGCACCGCATTGTTCGAGTCTTCTCCGTCGTTCGGGCGAGAAGGCGGAGATGGCTCGACGAGGTCGCTTCCGACGGGGCAGAATGCGCAGACCT
CAATAAGCTGCAGCAAACCACCCGCACCGATCATGACACCGAGCACTTCGTCGTGTTGACAAAGCTTGGATATGCAAAACAAACTGGTTGCTGCTGCCTC
GGCCGAGTGCATCGTGATGTTTTGCTTGGATGACAGCTCGAGGAGACCCGAGATGACGATCGGGTTCTTGTTGAGAGCCTGTACACCTTCCTCTTCCGCG
GATAGCGTTGTCAGCAGGTCCGTTACACGACTCAGCAGTGTGCGTGCGACGTTCAGCGTCGACGCCTCCCCACTCGCCTTGAGGAGTCGTTGATAAGCAG
GGTTCATCATTTTCTCCAGCGCCTCTCCAATTGTTGCGAGGCCGAAATCGGACAGGAACTTGCGACATATCGAGGCATTCGCGCTTGTGGTCTCCGGGAC
ATGAAGCAACGCGGTCATGAGCTCGAGTGCGAGGCTGCCTCGGATTTGGTCTGGTTCGCCTAATAGGGAACGACGGAGCGGCAACAGCAACGTCTCGAGC
CAATCTGCCTTGACTTCGACGGTTGCGCAATGAGTGGGAAGAAGTCGAACCAATGCCTTGAGGATAAGCTCTTGGATCTGCCATGGCTCGACAGACGAAT
GAGCCAATCGAGATGAGCTGGCTTGGTACGCCTCCGAGGCTCCAAACACGGATCGTGTGCGAGAAAGATCCGTCAATCGAACGAATAGTGCATCAATGAG
CGCACGGAACATATCCTCCGTCCACTCATTGAGGAATTCTCCGTCTCCTTCGACATACGAGCGTAAGAAAATGTTCCCCACGAAGATCTCGTCATCAATG
GTCTCCGTCGCTCCTTCATCGCTGTCTCCATCCACCCCGACCATGACCGCGTCGTACTCATCCGCTTGATTGTTGGCACCCCCGGATGCCACAAACTTTC
GCTTTAGGTATTTGAACAGCTTGGAACGTTGACGGCACCCCCACCACACATCGGCTGACCGCTTTTCGTCGGCGTTGAAGACTTCACAGAACAATGCTGG
GTCACTCGATCCCAAGAGCGACCCGATACCACATCCATCAAACCCGACAGCTTCGTCAAGGAGTAACTTGAACTCAGACTTGGCTTTCTTCTCTCGCGGG
ATCTCAGGTGACTTTCGCATGTGGCTTGCCGTCTTGTGGGCGGATGGTGCCTTTGGTGGAGACACCGCAGCTGCGACACTGTAGTTCTCCTTGAGGAACT
CAGCCGCCGCCTCCGACATGCATTTTCCATTCGGGTCACAGCAAGCAACCAAAATGTACACCAGTGCCAGAGACTTCCAATTGGCGTCAGTCGAAGATTT
GGATGCCGAGTGCGCTTGCCCTGGGGACATGAGTCCATTGGTTGCGTGGGTAGGCAATACGGAGGTCGCATCGAGTTGCGCCAATTGCTTGAGAATCGTA
AGAATGCGACCAATGGTGACATGGTCTAGAGTCTCGACAGCGAGCAGTCGACAGATGAAGACGCGTTTGGGACGAACGATCTGCAGAGTGAACTTGAAGC
GACGAATGATGGCTTGGAGAACACTCACGCCTGCACGCACCAAACCGTCACTTCCATTTCGCACTTGGACTTGCTCTTCGTCAAAATCAAACGCCGGATC
CATATCGTCTTCAATGTTGCTTTTGATGGATCGGGAGCTAGATGACCTCGACAAACTGCTGATCAGTGTCGAGTCGGAGAGTACATCGACGACTGCGGTT
GCCACCAGCACACTGACTTGATTGAGGCTCTCGGACGGCGCATTTCTCGTCGTCATGATGGCTGTGCTCAAGAGCAAGAAGCATTCGCGGATGAAGGCCG
GCGAGTATTTGGCGTGGTCACGCAAGAGGTCGAGCACGTAACGTGTGGGTAGTTGGCCATTCAGCACCATCGCATATCGACGAATCGCCAGTCGGAGGCA
TCGCAGACACTGCATCTTCCACGGTTCGTGAGTCTCCACAGCGAGTCGGTCCGAGAGATGCCAGGCCAACACGAGCGGTTCCGGAACTTCAAACTGGTTG
GACAAGTCGGCCAACATGGGGATCAAGTGGTCAACGAAGAACCCATTCACGACGAGCTCCTTCTGAATCGATCGATACTCAACAAAGAACATCTCGTGAT
CCCAGCGAACGATGGTGGCACCGGCAGTGGCACTTGCCGCTTTCTTCATCAGCTCCAGTTTGTCGATTTCCGATCGAATTGCTTGTCGTAGTTCGTCTCG
CATGGCATCTCTCCACACCAAGTCGGGCCGTTCATGGGTGTCCTGAACCGACTCCATGATGCTCTTCCAGTCTTCGCCTTGCGATCTTGCCTCTTGAAGC
CACCTCTCAAAAGCACTGCTCTGACCTCCAACCTGTCTGGAGGATCCAGGTGCGAGAGACACACCACGATTCCTCTTGTTGTCGAGTCCTGAACGCAGCT
CAAAGTCGAAGGTGAACGATGGCAGCGATCGGTTGTGCCGTGTACTTTTGAGAAGCGAGGACGCCGTGTGGCGAGAGATAAGCTCTGCTCGATTCTCTTG
CGGGATGAAGAGCTCCACAGGGAGGATGCGGCTGATGACTTTCTTGGACCGTGTGTTGCCGGCGCAGAACATCTCGACGAGCTCTGTGAACTTTTCCTGC
AGCGCGCGCGCCGAATTGGTTGGCGTGAGATCGCCACCGCCATCGGATGTGTTGCTACTTTCACGACTGGTTTTGCCCTTCTTCGTGTGCTTCTTCTTGC
GCTCCTTGACGGCGATCGATAGTGCGTACAGCAGTGCGCCGTATTCTCGGGCCGACTCCTGCAGCTCATGCACTTGCTCCAAGTCGATTATGAAGAATAG
CTCCTTGACCAGATCCATGGCAAACTCTTGGATGATTTTGTCCGAGTGGTGGCACAGATCAAGTAGCGAGATGCGGGCATTAAGCAGTGCGTTGACGACC
TGGGCCATGGTCGACCCATCGGTTGTGTGCTTGCGGGTCACCAGCGCGGCGTGAAAGAGCTCGAGTACCAGTGTCAGCACACTCTCGCGTTCGCGTTGAA
CGGCCGTAGCGTGCTTGCCGCTGCTGTGGTCCACCAGAAGCGACCTCAATACGTCGTACCCGCCGCTTTCGGCAAAGTTTCGGCGGTTGAGGGACTCCCA
CTTCTCCGCCTTCTCACTCGTCTCGGCGTTTGGACACACTCCCGTGAGACTGAGCAGTACCTGGAGTGCAGCCTTGGCAAGCGTCGGCGACAGTAGCTAA
ATGACCACGATGAGAAAGCCACAATATCAGACGCTTGTTGCCCCACCAAGTCCACTGGGCGTCAACCGTAACGTACGAGGCAGTTGAGAAATGGCTTCAT
TGAGCACTTGGCACCGAGGCGATAGAGCTCACGCCAGAGGATCACGCGCTTGAAGCTTGTCAGCGTTAGCTCAATCTAGATCATTCTCCACCGAGTCAGT
CCACACCCACAATCGCACACACATGAGAAAAGGCACGCACCAAATCTTCGTTCGAGTTCTTCTCCGTGCGCTCGGTCGCGCGCTGGAGCAGCCCGTGCAT
GACGAGGAACAGCTTGCTCTCTTTCACATCGAGCACGCCGCCCATGGGGTCATCCGTTGCCGTTGGTGTCGTGGCAGTCGAGAGTGGCGCGGTGGTCGCG
GCTTCCAGAGGAAACATCTTGCAGAACGCCTGCAGCGCCGCCACAATCGCCGCTTTGTCAGCCGCGCTGTTGCCGCTGCTCGCATTCGGCTTGATGCTGA
CGACGTCGCGGATGGCGTTGCGCTGCTCCACGGAGCCGGCTTGCCCCATGGCGGAGTCGAATCAGCTTGAACTTGGAGAGCACTTGTCGTGGCGCGATGG
GACCGCCGCGAATCGAGTCGAGTGGCGTCCGCACCAGGTGCCGATACACACGCTGGCGGGGCGAAGCGCGAGTGGGGGCGTTAACGGGCGTGTCCGCCAC
GTCCCGTTCC