Description :
From Genome Similarity Track
Location :
scaffold_1068:354- 1873
Transcript NameFunction/comments
Pl_101399hypothetical protein PHYSODRAFT_258618

Sequence
1519 bases(100 bases per row)
TAGTGTTCGTGAGCAGCTGTGTAGTTGTAGTACACAGTGCTCTCATACTCCGGTGCACAAAATGGGAACTCCACTCTGTCGCTGGGGAAGAAGAGATTCT
CGCCCGATGTGTACGTTACGTAGCATCCAAGACAGAAACACACCACCGTAACGATTACAGCCATAATCTTCTCCCAGATTGGCATCACAGTCCATTGTTT
CTTCATCAGAAATACGATCGGTAGGATGATGGAGTGCATCGTGATGCACGAAGCTCCAACGAAGTCCGATAAGTCCGCGAAGTGATCTTTTAGAATCACT
GAGGCAACCACAAGAAACGCGACAATCGTAATTCGCAGGGTGATGTACTTGATAGCGTTGGCGCCGCGGTATTCGGCGGCTTCAGCTTCTGGTTGTTCTA
GGTGAACATTTTCATTGTCAGCAACAGAGATAAACGAGCGCTTCGAGAGCCGGGATTTCTCGAGGATTTCCGCAGTGTCGTTTGGCGTGGCAACCTCTGC
GTAGCTCAGCGGATTGTTTTCGATGTCGTCCGGCATTGGCTTGTGCATACCAAGGATTAAACGTTCAGTAATGTAGAATGCCGGGTTCAAGATGACAGAG
AACGCGATAGTAATGTGCAACTGCATGAACATGTAGGCGAGAACAACAGCGCCCCAATCCGAGGCGAATCCCAGTGTGGTCAAACCGGTGTCTGAGTCCG
GGTAAATTGACCACAGCAGGTTACCAGAAATTTGGCAACCTACAGAGGAGTACGCTGTGCTGGCCAATACCAGGAAGCAGCACGTTGTGAAGGCCATCGT
AACGAATACGACACGAGGCATCCGAGTGGGGTCACTGTGCTGACGCTGTAGGGCTGGGATCACAATTCCGGCACCGTATGCGAGAGCCAGGTTTCCGAAG
GCACCAGCGACTTGCTTGAAGTTGAGATCAGGTGCAGGAGCAGTCGGATGACCACGCATGCCGTACATGACAACTGCAATACCGATCACATCCGCAACGA
GTGTTCCCATGCAACCGGCGAACGCAGCACCTGCTCCTTCCTTGAGAGTTGGCACGAGACATACAGGCAATACCAAGAGTGCCATGAGAATAGACCAAGT
CGTCGTACTAAAGGCACCTGGGTAGAGACCGTCAAGAAGAGTGCCACCAAGAACCAGGAACACGCACGGGACGATCAAGCAGTTGCCCATTTGAGCTATG
ACAGTGAGGTAACGGCCCCACTTGCCCATGACCCACTCCCCCAGGTCGCCGTAGGTCCTGACAGTCGTTGGTGCGAGCAGCATGACGCGGCAGATGGCCA
CAGAGCCGTAGATATTGGCAAAAGCCATGAAGGCCATAGCGACGATTGCGAGACCAGGACCAGCGCGGGAGAAGTTACCCGGCATGCCGAGGGTACCAAT
ACCGTAGACGCAACAGAAGAGGTTGAAGGCTGCCTTAGCATCTTCCATCGTGAAGAAGGGTTTGCCCATGCTGAAGTCTGAGTCGCTTGGGTAGGATGTG
GTAGATTGAAGACTGAGCT