Description :
From Genome Similarity Track
Location :
Scaffold_2053:354- 1556
Transcript NameFunction/comments
Phymu_g13847hypothetical protein

Sequence
1202 bases(100 bases per row)
ttgcacgcttcctcaGCTCGGTAAGAGACTTCGCACCGAGCtacttcgacgacgtgttcGGCCATAGCCGGGCTAAGACTGAAAAGACGGACGTTGAGAT
GGACAGGGTGCATCTCTGGAAGCTGCTAGAGCTTGTAAGGAAACATAAGCTTTATGCGAACCTGAAGAAGTGTATCTTCGGGGCGAGCAAGATGCCCGTG
CTTTGGTGTCTCGTCGGGACGGACACGTACGCCCTGACCCAGAGAAGGTCAGAGTGATCGATGAATGGCCCACGCCATTCAATGTGAAGGAACTGAGGCG
GTTCCTTGGGctcgccacgtacttgagcaagtacgtggagaacTACGCGGGCAAGATCCACCCGCTGTCACAGCTTCTTAAGAAAGAAGCTGAGTGGAAT
TGGACCATCGAGTGCCAAGGGTCATTCGATACAGTTCAAGCATGGCTTGCCTGAGGCGCCGATCTTGGCAGTGGCTGACCAAGATCGTCCATTCCACGTG
GTGTGTGACGCACCCGACTTTGCGATCGGATGCGCATTGATGCAGCACGATCACGAGGGGCATGATCGTGTGGTCTACTACCAATCGCGTGAGCTGAAGC
CAGCTGAGTGTAACTACTCCGTACATgccaaggagctccttgCCTTGTAGTATACATTCGCAAAGTTCCGAGTGTATATACTTGGGAGTAGACCATTCGT
GGTCTATATAAATCACGCATCATTGCAGACAGCTATCAAGTCACAGCACATCGCGCAACGTATGGCGAGATggttgtccttcttcgtggagcCCAACTTC
CGGGTTGAGTACAAACCCGGAAGACTCAACGTAGTGGCCGACGCGTTATCGCGTCGACCTGTCCATGCGGAGACAGTCGACGTCAACACAGTTGGCGTCG
TGAGGCCAAGTGTTCCGTCGTAATCGTTACTTGGCGACGTGAAGAGCGCGTATGCAAGACATGCAGACGCGAAGGGGCTGCCGGAGTACCTCACAGCACC
TTCCGACGAGGCGCGTCGGAAGCTAACCCCTCAACTTCGGGCTCATGTACACGGTGTGCGACTGCAGTACTGTGCAGTAGGCGACAACGCGAACCGCATT
GCCGTTCCAGTTGATCATGATCGGCGATTGGGGATCATGTTCGAGTACCACGATGCCCCTATAACAGGGCATCCGGGTCGTGAGAAGGCGcgtgttcttc
tc