Description :
From Genome Similarity Track
Location :
Scaffold_2856:354- 1479
Sequence
1125 bases(100 bases per row)
AGCTGGTACAGCGCCGCACCATAGACCGCGAAGTCTTGAATGAAGCGGCTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTGCTCGTTG
GAAACGAAAGCTCGGTGATGGCCGCAAGCTTCTTGGGGTCAGCTCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTGGGTTGGCAAAA
GATGCTCTTGGTGAAGCTAATGCTGATCCGACACTGTGCAAATCTTGCTAGCAATCGGTCCAGCGTCGCTAGGCAGCTGTCGAAATCCTCGCCACCGAAG
CAAATGTCATCCACAAACGACCGTCGACCAAATACAGGTACCAGCGATGATTCGTCTGGCTCCCCGTTCGTAAACATGTCAGCGACGGGGCTGTTGACGA
GTTGTAGTACAGGGTCGGTCTCTACCGGTGCTTCGCGGTCTGCCGCGAACTTCGTTTGAAACGAACTCTCGGCGCTTGGCCCACGACGTTCCTTGGCCTG
TTCTTCAGCTAAACGCATCCTCTCCGAGTATTCAAACCAACCTCCTTTAGGTTGAACGAACCCCCAGAGTGCGTTGTCATTCATACGCTGGTAGATCATC
GGCGCGATCTTTAACCCGAATGGCATGCGTAACCACTCGAAATGTCCGAGTGCGCAGACGAACGCCGACGCCTTACGCGCTCGCAAGGTCATCATGACCG
CCCAGAAGCCGCTTGCAGCATCCAACGAGCAGAACCACATGTAGTGTTCGAGATCTGTTAACAAGTCGTCGACTAGCGGCATTGCATACTCCATGATCGC
GGTGATAGCATTCACCATCTTGTAATCAATGCAGAGCCGGATGTCCAGCCCGTTCTTTTTCATCAGAATTACGATCGGGGATGCCTATGGACTATCTGAA
AAAACGATCAGTCCAGCTCGCAGCAGAGCACGCAGCAGCTCGTACAGCTTGCCGAGAAATCGTAGCGGCACGCGCCGGGCAAGCTGTTTAATTGGAGCGT
GCCCCTGTGTGTCGATATCACATACCGTGCCGTAGGCTGGCGGCGGTAGTGCGCTACCACTAGCAACCAGGATCTGCTAGTGGCTCCTCAGTGTTGCGAC
TAGACGTTTCCTTCGACCGGTCGAC