Description :
From Genome Similarity Track
Location :
Scaffold_8:353967- 356351
Sequence
2384 bases(100 bases per row)
GCGCTTCGTCCACAATGGACGAGAGTGTCTTGTATACTGACAAGGCAAAACGCGTTGCTGCTCAAGGCTGCGATGCCTTGTAAAGCAGCCCGTTTTACGA
AGTTCAGTGGAAGCTCTGTGGTGTCTTTCCTACAGAAGTGCCGAACCGCCTACCGGCCGATACGGGTAGTGAGGCACGAGATTGACTTGGAACCTGGCAC
CAAGTATTGTGTGACCAGGCAGTGTGCGTAAGGCAACAGGTAGTTGGCGCGTAGTTCATGCTTCCAATAAGTTGTACACGGCCACCATCCCAGCGCAAAC
ACCGATCCCTCGGAAAGATGTCCTGTTAAACTTAATGAGTAAGTCAATTATCTTTTACGCACTGGATTTGAAGGATGTCTAATATTAGGTACTCATGAAT
CAGACCAATGAAGCCAAGACAGCAGTTTGCACCCCAAGCGATATGTTGTGGGAGTGGCTAGTGATACCGCAAGGGCTGAAAAACGCACCAGCGACATTCG
ACCGTGTGGTATCTCATGTGATGCATTTACACCGTGCATATGCGCCTCATTAATTTGAAGATGTGTTCGTACATAGTAGGGCCGAGACGGGTTGAGTGAG
ATATAATCGCACAAACGCCATTTGGACGTTGTGTTGCAGACTCTGGGCGACGCCCAATTGTACGTAAACTTGCAAACGTGCGTCATAGGGGTCCCCGAAA
TACCTGTACTGGGCTGCATCGTGGGTATACACGGTGTTAGAGCAGACCCAGAATAGGTTAAAGCTATAAAGGAATGGCCAGTGCCATTACATGTGAAGGA
TCTGCTTCAATTCCTTGGACTTGCTAATTACTTGCATAAATACAACAAGAATTATACAGAACGAACCAAACCAATATCTGAATTCCTGAAAAAGACGCGG
AGTGGCTTGGCCTAAGGCTCAAGTAGATGCTTTCACTTCAGTGAAGCAATCACTTGTAGAGGCTCCGGTCTTGGATTTGCCAGACGCGGATAATACCATT
TGTGTTGTCTACGATGCAAGTAATTTCGCTATCGGCAGTGCACTTATGCAAAAAGATAATGAAGGCACTGACCTTGTCATCTCGTATCATTACCGGCTTT
TAAAGGCCGCGGAGCTAACTTACTCCGTGCACGACAACGAGCTACTCTCTACAAAGTATGCTCTTGTGAAGTTTTGAGTGCACCTATTGGGCATCTAAAC
TTTTGTCGTTTACACGAATCAAGCATCGCTTCGGACCGCGATAAACTCGCCGCACGTATCACCTAGGGTGGCGAGGTGGCTCACATAATTTTCGGAATTT
TATTTTCGAGTTGAATACAAACTGGGTAAGTAGATTGTCTTGGCTGAAGCGTTATCGTGCGGACCAGACTTCGAGGAACGACACCTTGAAAACGTGTCTC
GTGCTAAAGCACGAAGTGAGTAGTCAACACTGGCAGCCCTACTGGTTGACCATGTGCAAAACACTCTGGACTCTGATATAAAGTAGAGCTACATGCAGGA
CGAACATTGTCGTCTGCTTATAGATCACTTTGGTGGACGAAAAGTTAATCTTCCGTCTCACCTCAAGGCAAAGCTTAACCGCTTTAGTTACAGTGATGCC
CTGTTATGGCATCAAATATAACCTTGTGATCCATTGAGAATCTATGTCCCCCATGACACAGATCTCAAACAGAAGATTCTCTACGAGCTCCATGATGCAC
CATCAAGTTGACATCTGGGCCGTGAGAAGACATTCTTACGAGTGTCAGATGAATTTTGGTGGCCACATCTATATCGGTGGGTAGCCAATTATATTCTATC
ATGCGAAGAGTGTCAGCGCGTAAATCCTGCACCTTCTAGTAGTGCGCTACTGAAGCCACTGCCGATACCAACTGATTGTTGGAAGCCGTTCAGTTTGGAC
TTCATGTTTGGCATGCCACCTGATCATACAGGCAGGACTGGTCTCGTAGTCTTTGTTGATAGAATGAGCAAAATGGTGCGTTTAGCACCGTACAGCACCA
AGACCTCAGGCAGCTTTCTTGTTCCTGGATCACGTTTATCGGCTACAAGGAATGCCCTAGTGCATAGTTTGGACCAGGATCCACGTTACGTCAGGATTTT
GGCGTCATGTGTTTGAGCTACTTGGTAGCAAGCTCCACATGTATACCGCCGATCACCCACAAACCGACGGCCGAACCGAAAGAGCCAATCGTGTTGTGGC
GGATGTATTGCGCACAATAGCAACCCCTAAGGAATGGAGCAAACATTTGCCATTCGTGGAGTGTGCTATTAACAACAGTGTTCACGCCAGTACGGGTAAA
AAACCATTTTATGTTAACGGCTGCACCATCCTCGGACGCCAGTCTCGTTTGTGCGCAGCCCGAGTCTTAGTGGGGGAAGGCCCC