Description :
From Genome Similarity Track
Location :
Scaffold_151:35395- 36976
Transcript NameFunction/comments
Albla_Nc14084970

Sequence
1581 bases(100 bases per row)
AAACGCGACGGTAGTAAAGGTCCCATCCGCAGCGAGCGCGCGTTTATCGATTTCCAACGGCAAACAGACGCTTACCGCGCGCCATTCGAGCGCGTTCACG
ATTGGAATGAGATACACAGTGTGAACGAACGGGATCCAAGCGAGCGACGCGTGCAAGCTGCGCGCTGTATGGACTGTGGAACGCCATTCTGCCAAACACA
CACGGGCTGTCCCGTAAACAACCTGATCCCCGAATGGAATGAGCTCGTGTATCGCGGGGACTGGAAAGAAGCGATCGAGCGATTGCATAAGACGAACAAT
TTCCCCGAATTCACTGGACGCGTGTGTCCCGCGCCGTGTGAGAGTGCTTGCGTCGCAGGCTTAATCGACGATCCAGTTACGATCAAGAACATTGAGTATG
CGATTGTGGATCGAGCGTTTGAAGAAGGATGGATATCGCCTCGGATTCCAAGAAGAAATGGTTTACGCATTGCGATCATTGGCTCAGGACCAGCAGGATT
GGCCGCAGCGGATCAGCTGAATCAGAAGGGATACCAAGTGGCTGTGTATGAGCGTGAAGATCGAGTCGGAGGACTACTTATGTACGGTATTCCCAACATG
AAGCTTGAAAAGAAGACTGTTGACCGTCGAGTGGATCTATTGGCTGAAGAAGGGATTGAGTTTGTTACCAACACAAATGTGGGCGTCGATGTTCCAATTG
CGGAGTTCTACGAAGAATTCGACGCAATTGTGCTTTGTATTGGGTCAACGGTGCCAAGGAGAGTGGAGGCGCCCGGGGCTGAATTGAGTGGGATTCACTA
TGCGATGGAGTTTTTGACAAAGAATCAGAAACGATTATTGCTGACGATTGATGGGAAATTACAGAGCGGATGGAGTCGAGATTTCATATCTGCAGAAGGA
AAGGACGTGGTGATCATTGGCGGTGGTGATACCGGAACAGATTGCAGTACGTATATACTTGTGGATGACTGAATGAATGCTCACTTTTTTGTGATTGTAG
TTGCTACTTCGATGCGTCAACATTGCAAATCCGTTGTCAATTTGGAGTGGAATGCGATGCCTCCACCTTCCCGAGCTGAAGGGAATCCATGGCCAGAGTA
CCCTAGAATTTACGGGATCGATTATGGACACGCAGAAGTTCGAGCAGTGTTTGATTCCGATCCAAGGAGATATAGTCGATTCACAAAAGAGTTTGTTGGC
AATGAACAAGGGCAAGTGACTCACATTATCACTCAAGCCTCCAAGCTCAATCCGGAAACAAATATGAAGGAAGCTATTCCGGGAACAGAGGAAACTCTAC
CCGCAGATTTGGTGTTACTTGCGATGGGATATGTGCATCCCGAACAAGAAATTGTAAAAGAGTTGGAGCTGCAAGTCGACCAGAAACGAAACATTCACGC
CGTTTATGGAACATATCAAACTTCAGTAGAGCGAGTGTTCGCAGCCGGAGATTGTCGACGTGGTCAATCACTTGTTGTGTGGGCGATTAATGAAGGAAGG
GGTGCAGCCGATGCCGTTGAAAAGTACTTCTTGCAGGAAGGATACCAACCCGAAGTCTCTCAAAACCAGCGATACGGATAG