Description :
From Genome Similarity Track
Location :
Scaffold_5:353868- 356794
Sequence
2926 bases(100 bases per row)
TGTTAGAGCTAGACGAAATGTCTGATGGCGAGTTTAGCCAGGCCTTGAAGGCAGGCGATTTATCCGAATTAGTGGTCATTAGACCCGATGTCGAGTTGAA
CTCGTCCTCATTAATGGATGAGTCGGTCCTAGAGGACACCAAGGCGGCACTCAGTGCCAGAGTAGATCTTCGATCCTTAGAGATCCTTTGGATCCATTCT
ATCCTTTGGTAAAGAAATTTCAAGATGTGATGTGTCACAACCCACCATCTGTCTTACCTCCCGATAGAGGTGTAAGTCATGAAATTGACCTAGTTCCAGG
AACTAAATACTGCGTAACACGGCAGTGGCCTTTACCTAAGGAACAGTGTGACGTCATTGACGATTTCTTTCGTGCTAAGCACGCGGCGGGAGAGTAAGTC
GCCCCATTCCACACCTACGTCTTGTGTCAAAAAGCGTAATGGTAAGTGGCGTATTGTGCCCACTTATAATAAGCTCAATGCTGCCACTATCCCGGCTCAG
ACACCAATCCCCAGAAAGAATGCTCTTCAGAACAATATGGTGGGATGTACATTGTACAGTGCGCTCGACTTAGTCGATCGTTATTACCAGCTGCTCATGC
GAGCAAGCGATATTCCGCTAACAGCGATTAGTACCCCGAGGGTATGCTCTGGTAGTGGCTCGTTATGCAACAAGGGCTGTCAAATGCCCTGGCTACTTTT
AATTGTCTGGTGACGCAACTATTCAGACCTCATCGAGGCTATGCACAAACGTACTTTGATGATATCTTTGTCCATAGTTGTGCAACGAACGGTCGAACTG
ATGTGGATAATCACATTGATCATTTACGAGCGGTGCTCGAGTGCATGCACAAATAAATTGTATGCAAATGCATCTAAGTGCATCTTTGGTGCAGAAGAGA
TTTACTTTCTGGAGTGCTTCATTGGAAAGCGAGGCCTTCGAGCGGACCCCGCTAAGGTAAGGGCCATAGTCAATTGGCCGGTTCCAAAGAACCAGACAGA
TCTACGTAAGTGGCTTGGCCTTGCCAATAACCTGCATAAGTATAGTGTGAATTACGCAGACATGGCTCGGCCATTATCCAATCTCCTTAAGAAGGATGTG
GATTGGTGTTGGGGTAACACCGAGCATTGGGCTTTTCAAGCAGTTAAGGAAAGTATCCTTCATGCGCCAATACTGGCTTTGCCCGATCCTGATCGGCCTT
TCAGCGTCGTCTGTGACGCATCTGACTTTGCCATAGGCAGCGCTCTGTTACAAACAGATGTCGATGGACGCGAAAGCGTCATTGCATTCGAATCTAGACA
GCTCAAAGCTGCTGACAAGAACCATCCAGTTCATGACACGGAGCTACTTGCTATGAAGTACGCTCTAGTCGAATTCAGAGTACATCTGATTGGCTCAAAG
CCATTTGTGATCTACACAGATCATGCATCATTGCGCACTGCGACACAGTCGCCGCATCTCTCTCAGAAAATGGCTCGTTGGCTTTCATTCTTTGCCGAAT
ATAACTTCGAAGCGAAGTATAAGCCAGGAAAGCAAAATGCTCTGGCTGATGCGCTATCGCGCCGACCTGACTATGAGCTTGCTCACGTCACTACGCTGTC
ATCGTCAGTCACTGACTTAATCCGTGCGGCTTATGCCAAGGATGAACAATGTGTAGCTTTGCTACGTCCTCTTGGGAGCGAGGAGTCGAAAGACTCGGAC
ATAGAATTGTCGGCACGTTTACGTGCGAGGCTACATCCATATTCTATCGATAATGGCCTGTTGTGCTATCGCACATATATTGAGGATAACCCTCATATTG
CTGTCCCTCATGATGAGGAGTTGAAGTATCGAATCCTCTATGAGGCACATGATAGCGCTTTAAGTGATCATCTCGGTCGTGAGAAGACCTATAGCTCAGT
TAGCCAGGCTTATTGGTGGCCCAAACTATACAATTGGGTGAGCACCTATGTGCGTACGTGTGAAACGTGTCAACGGGTGAAACCCTCAGCACATGTGGCG
GCGCTGCTGGTTATTCTGCCTGTGCCCACTGGGTGTTGGGAGTCCATGAGTATAGACTTTTTGTTTGGCGTGCCGAAAGATTCGGAAGGCAACACTGGCA
TTGTGGTCTTTGTTGACCGATTGAGCGAGATGGCTCATCTAGCGGCAGTGCCGGACTCTATTGATGCCGAAGGTACAGCGAAGCTGTTTATCGATCGTGT
GTTTTGACAACATGGTTTGCCAGTGGAAATTGTCTCTGACAGAGATCCCCGCTTCACTGGGCAGTTTTAGAAGTCCATCTTCAAGGTGCTCGGCACCCGT
TTTGACATGTCCACAGCGGATCATCCGTAGACCGATGGTCAAACTGAGCGTGTTAATCGCGTCATTAATGACATTTTGCGCAGTGTTTGCGCTGATACGC
CTATGCGTTGGAGCTCCATGCTCCCTGTTGTTGAATTTGCGTTGAACAACGCTGTTCATGCCTCTATAGGCTATACTCCGTTCTACGTAAACGGTCTCAC
CCACCTTCGCGTTCGGTTGACGCTACCACTATGTGGTTCAGGGCTTGGTGGGGGAGAGGTTGCCGATCGGCTTGGTGATATCAGCCCTGCTACTATTCAA
AAACAGGTAGGCGAGTTTCTCGCAACGCGAGTGAATGTCTTAAGACATGTGCGTGACGCAATGGCTGAAAGCCAAGACCAACAAAAACAATAAGCGGATG
CTAAAGGCGGAAGCTGTATTGAAAGTTATGAGGTTGGTGACCGAGTCTTACTAAATGCTAAAAACCTACCTACAATGTAGTGTCTGCTGTGTATAAGACA
AAGTTTCGTCCTCACTTCATTTGACCATTTACGGTCGCGGCCAAGAAGGTCTTGCGTATACACTCAACTTACTGCGCGAATTGCTTACACACCCCGTGTT
TTAGGTTGGCCTCCTTAAGCCGTATC