Description :
From Genome Similarity Track
Location :
Scaffold_68:35381- 39732
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_68-fgenesh-gene-0.10High mobility group protein B1
Pytve_DAOMBR484maker-pve_contig_68-fgenesh-gene-0.11Elicitin (INF1)

Sequence
4351 bases(100 bases per row)
GAAGCGGGGCAGTGGCCAACCTGCTCTCTCGACCGCTCCGCATATTGAACATGTCGAGAACGCGGTCCGAAGTAGTGAGGGACACGCGTGCAAAGGAGCC
ATCTACCATCCACCCGGCTCTGCCAGGATAGACGTGGTGTGTTTCGATATGTGCGCGGCGATAGATGGGGCCGCAAAACGTCACGTCTACACTGCCCACA
CGATCAGATAGCCTACCAGCCGCACAGGACAGGCGTCAATTCGGGTCGAAATGCAATGCAGGCGTTGTTGTTGATTCATCCAGTATGTGTGTGGGTCACT
TGATTTAGTCAAACGGGCGGCATGTAACGTGGCGGCGGTGCTGAACCCTCGCTGAGTGCGCGCCAATCCATCGAACCGAAGGCAGGAGCGAGCAACAATC
AGCCACGTCGGAACGTGTTCAGCAAGTGCGGGGAAGCAACGCCATCGATCTGTGCCAGGCAGGCCAGTGTCGGTCAGCAATGGGAGGTCAGCGCGGCAAG
CTAATGGCGCGACCACTCCAATGGCGCCGTCACCAAGGGCTATGAGCATGAGCAGTCGACCAGCGATGGGCGATGGGCGATGGGTGTGGCTAGTGCTATC
AAACTGTAGACGTCGCGGCAATAAGCTGCGCGACGGGAACGGCCAGGCCAGTCCGCGTTGAAGGACTTCACGTAGATACCAATACTCGCACGAGTATACC
GACACTGGCAACACGAGTCGCATACCCGCCAAGTGGAGATCCGACTGCCGTCACTCCACTCGACGTTAGACGACCACACCTTGCGGTTATGACAGCCAGC
CACTTTGTTTAAAATACACGGAGCACTGCTGGCTCGTCACTAAGCACCTAGAGCGTGCCGATGCCGAGACCCTCGAACTCGTGGCCCGTCAGCCCGAGCT
CCTCGGCCGCCGCAGCCTCGACCGCGGCCGCGCGACGTCCTGAAGCAGAGCTCGACCTCCCCTTCTTCCCCTTGAGGCCGTTCGCGCTCGACGGCGACTT
GGCTGGCCGCTTGACGTTCTGTTCCAGCAGCAATGAACCCATCTCTGTCCGTTAGCGAGCTACCCCGCGCCAGTTCTCCTTGTATTGCCACGTACGATCG
AGATGCCGAGCTCCTTGCACAGTGCCTCGGCCTCGGCCCACTTCAGCACACCGTACTCGAGGCACCACTTCTTGGCCATGCGGCTCTCGGGCCGCTGCTG
CAGCAGGCTCTCGTAGAAGACGCGATCCGCGTGGCCCTGGCGACGGGGACACAAAGCGATGGGTGGATCAGAGTTAGCGGCGCGTGGGGGACACGCGGCA
AACGGCTGCGCGACCTACGGGCGACGGCGTCGGGTGCTTCTGGCCCGGCTTGCGGTTCGCCTCCTGCTCCTTCGACCACTCCTCCTCCTCGATCATGGTG
GCGGCGCTTGGAGGTTGGTTGCTTCGCGGCCACGATGAAAATGGTGGGCAATTGGATCGTACGCGGAAGCAAAGAATAACCCATGTTTTCATCTGGTTTA
TTCAAGCTCACAGTTGAGGATGTTGGGTCATTGGTGCAATCGAATGGAAGGTGAATAGGGTCGAGTTGAATGCGCTCGGCGAGCCTGTCCGAGTCTTGAC
GCGTTCGATGTGACCAGGCGACAGGCGGCCCGCTCGGACGTGCTGGTTGCCACGTGCAAGATCGATCGACCGGTGTTCGTAGCCTCTCTACGTATGTCCT
GTCGATATGGGTGTTGAGAGTGTGAGTGCTCGACAGTCACTGCCTGTGCTTCGAATGCACCGAACTCTCCAACAGCAGCGCCGTGCGCAGATTCGTATCC
ACGCTGAAGATCAAGCGAAACAAAGAACAGAACAGCAGGCACCACAAACGCGTAAAACACAACGTTCATTGGCATTTCATCGGTAGCTGCATAAAGTAGC
TAGGAAACGAGACGCCTCTCGGTGGTTGATAGCAGGCGACAACCTGGCGGACTGTGGATAGAGCGCAAAGCAGAGCTCATACCGCTTACGCGGAGAGCGA
CGAGCACTTGTCCGAGAAGCCGTTGGCGTACTCGTACACGTTGAGCACCAGGCCGCTCGTCGGGACCGTCAGGTCGCAGTCAGGCGGGTTGGCGGCGATG
ATGGTCTTGATCATGCCCTGGCAAGCCGTCGACGAGCACATCTTGGTGTACTGCTCCGTCGTCGGGAGAGCCGTCGCCGTCAGCATCGAGTAACCCGAGT
CCGTCGAGCACTGGTTGAAGTTCGAGTCGCTCAGCAGGCTGATCAGCGCGACGTACGCGGCCGTCTGCTGCGTCGTGGTGCAGGCCGTGCCGGCGACAGA
GCCGACGAGGGCGGCGGCGGTGGCAGCGAAGAGAGCGCGGAAGTTCATCTTGAGGGCTGGAAAGGAGGCGAGTTGGTCACGAAGGAGCAAATTGCAGAAT
GAGCGAGGGCTGTCCGGCCGATCCGTGCGTCTACAGCGCCAGGCAGGAGAACCCCGACCGCCAGTCACATCACCCGCCGAGTGGCCATACAAGCAACGCG
CGCGTCCAGATCCTCCGAGCTTTTCTTGAACCACGGCCAGGGAGCGCGTTCCCCGTCATCAAGGACAGATTCGCGCTCGCTCGGCAAACGGGACTGCGCG
CTGCCGAGCCGAACGGCAAGGAAGTGTGAGCCGAGGACACTCCAACAGTTGGAAAGAAAGGAGTTGTGCTTTCACTGAATGCTGTGTAGCCTATGCTACC
TAGCTTCCCAACTTCGCTCGACAGGATACACTTGCCAAGATATGCCAACGTCAACCGCGACAAAGCGCGGGCGGAGCGGAGGTGAAACACCTATTTTGTT
TGTTTGTATGTGCATGGGTATCGCTGCCGATCCCGTGGGTTTTGCCTCCCCCGTATTGTGCTGTAAACCGAGTCAATAGAATGCATGGCTGTGCGTTCGA
ATGGTCCCCCTCGATCTCTGCAATGGCCGTCTGTCTGTTCATGCTGTGCTGGCCTATTGATCCATGGCGGTCTCGCAGTGGTCGTGTTCGAACGGTGCGA
TTCGAAGCTTTTGCTGTGCGTGAGTGACTCAAAATCTCGCTACCTTGAACTCGAGGTTGGAACCGAAGACACCCCGGCGGTTCGATTCAGCGGAGCAACG
GACGAGGTACGGTAACGGATCGAAGGGTCTTCAAGGTCTGATGCAGCGTGAGAGACGAAGACAGACGAAGACTCCTCTACCCAGCCCGCGCTTCAAGGCG
TCTGCCAGGAGGAGGAGCAAGTGAATCCACGCGGACGCATAGCCGCGCCAGTCTGTCATGATCGTGTCCGCCGACCGGTCTCTGTGGCGGATCCCTCCGC
GACTGCGTGTCGCACTCGGATTCATCCCACTGCTCGCTCGCCCGGCTCGTCACTCGCCGCGAGCAATGGGATCCACTGCGCGCAGAGCCGAGGCCGAGCC
ATCACCGCCTCTGGCCGTCTGGCCGCGTTACGACACGCGCNNNNNNNNNNNNNNCCACCAGCCGGTCCAGCCAGGAAGATACAGAAGCAGCCAGCTTCGC
GCTGCCGGATTCGCCAGCCTTGCGGACTGAGGTGGCACGGACCCTGTTCGAGGTGGCAGATTCAAGTCCGTTCCTGTGTTCGACTGCGTCTGGCGAAGCC
AAAGGTGGCGGACCCGGCAGGCAGCGACCGCCGGGGTGAGCGCTGAGCCGAGCGAGGCAGAGCCGACCGCCTCCGGCTTCGAGACTTGAGGCGGAGCGGA
AACTGCTCTGGGACACGCTCTCCCGGCATGGGATTTGGTTGAACGTGGGAGAAACCCAGGATACACCTCAGCCTCTCCGTCACGTGCCGCTGCTGCATCC
TCCGAAGCAGGCGGACGGGCAGTGACAGTCGAGCTCCGGACGTGCTCGACCAAGAAGCAGCATCAGGTTGCGCGAAGTGAGAGATCCCTCGGCGAGCAAA
GGCGCGGCCGCCGGTGCCCCAAGGATCAGATGGGCAGTCTAGCCACGCTCGAGAACCAAGAGCCTTGAAGAGCTGGCCGCCGACGGCTGGAGCAGAATCC
GCGCGGAAGGATGCGGCGGAGTGACCCTGTATCCTCTCCCCTGTCTGCGCTAGCAGACGCGCGGCGTGGCGGCGTGCCGCGAGTGCCGAGCTCCTTCAAA
CATGAGCGGCCACGGAGTTGGAGTGGCCCGTGGCTCTGATCGTTGATCCTTGTGTCCGCGCACCGATCGCTCAGTCTTCAATTCGATCTCTCCACCTCAA
GTCCTCAAGATGAACTTCCGCGCTCTCTTCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCG
TGAGCATTCTGAGCGACGACAACTTCAGCCAGTGCTCGACCGACTCGGGTT